ID: 1004947264

View in Genome Browser
Species Human (GRCh38)
Location 6:20629727-20629749
Sequence TGACAGAGCTGCGGCACAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004947264_1004947275 24 Left 1004947264 6:20629727-20629749 CCCATTGTGCCGCAGCTCTGTCA 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1004947275 6:20629774-20629796 AGATGCCCCATGTTCTTCTTGGG No data
1004947264_1004947274 23 Left 1004947264 6:20629727-20629749 CCCATTGTGCCGCAGCTCTGTCA 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1004947274 6:20629773-20629795 GAGATGCCCCATGTTCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004947264 Original CRISPR TGACAGAGCTGCGGCACAAT GGG (reversed) Intronic
901724952 1:11234239-11234261 TGACAGAGTTGGAGCACAGTGGG - Exonic
906201099 1:43960930-43960952 TCACACAGCTGTGGCACCATGGG - Exonic
907332540 1:53680448-53680470 TGACAGAGCTGTGTCACCATGGG + Intronic
908419199 1:63943230-63943252 TGAGTGAGTTGTGGCACAATGGG - Intronic
909006332 1:70280654-70280676 TGACAGAACTGAGGCAAAAGAGG - Intronic
916647003 1:166796653-166796675 AGACAAAGCTGCTGCAGAATGGG + Intergenic
1063394993 10:5678239-5678261 TGACAGAGCTGAGGTACTAGAGG - Intergenic
1063672138 10:8107649-8107671 TGAAAGAGCCTGGGCACAATGGG - Intergenic
1069644305 10:69981396-69981418 TGACAAAGCTGCTTCATAATGGG + Intergenic
1070276931 10:75016293-75016315 TAACAGAGGTGAGGCACACTCGG + Intronic
1075649585 10:124118921-124118943 TAACAGAGCTGTGGCCCAAGCGG + Intergenic
1076070050 10:127482114-127482136 TGGCAGAACTGAGGGACAATGGG - Intergenic
1076773289 10:132678954-132678976 TGACAGAGCTCCAGCCCCATTGG - Intronic
1080529407 11:33160304-33160326 TGGCAGAGATGAGGCAAAATAGG - Intronic
1083276987 11:61602503-61602525 TGAGAGACCTGAGGCACAAAGGG - Intergenic
1091372435 11:135072349-135072371 TGACAGTGCTGTGGCACACATGG - Intergenic
1091606141 12:1953065-1953087 GGACAGAGCTGCTTCTCAATGGG + Exonic
1093647918 12:21610190-21610212 TGAGAGATCTGGGGCACAGTTGG + Intergenic
1096355458 12:50937571-50937593 TGAAAGAGCTGCAACACAAATGG - Intergenic
1111237837 13:85431700-85431722 TGAAAGAGCTGTAACACAATCGG + Intergenic
1113578699 13:111413159-111413181 TGACAGAGCTGCAGCTCATGGGG + Intergenic
1114206648 14:20578453-20578475 TTCCAGAGCTGGGGCACAGTGGG + Intergenic
1114990676 14:28284516-28284538 TGGCAAAGATGTGGCACAATAGG + Intergenic
1118488796 14:66239071-66239093 TGAAAGATCTGCAGCACAGTGGG + Intergenic
1124214988 15:27798989-27799011 TGAGAGATCTGCATCACAATTGG + Intronic
1132242706 15:100271359-100271381 TGACAGTGATGCGGAAAAATGGG - Intronic
1137264492 16:46857739-46857761 TGACACAGCTGCTCCACAAATGG - Intergenic
1143396590 17:6603996-6604018 TGACAAAGATGCAGCACAACTGG + Intronic
1149478404 17:56982548-56982570 AGACAAAGGTGCGGCACAATTGG + Intronic
1155172037 18:23274256-23274278 TGGGAGAGCTGAGGCTCAATGGG + Intronic
1159719833 18:71874742-71874764 TGAAAGAGATGCAGCATAATGGG + Intergenic
1160907417 19:1457973-1457995 TGGCAGATCTGCGGCTCGATGGG - Exonic
1162014354 19:7836459-7836481 AGACAGAGCTGCAGCACAGCGGG + Intronic
1168349173 19:55666243-55666265 GGAAAGAGCTTCGGGACAATGGG + Intronic
928785396 2:34879150-34879172 TGAAAGAACTGAGTCACAATAGG + Intergenic
932714648 2:74092554-74092576 GGTCAGAGGTGCGGCACAGTGGG - Intronic
933595976 2:84283734-84283756 TGGCAGATCTGCGGGACTATAGG + Intergenic
934886236 2:98028000-98028022 AGACAGAGCTGCAGCAGCATGGG + Intergenic
1180022638 21:45138130-45138152 TGACAGAGATGCAACATAATAGG + Intronic
950508959 3:13414286-13414308 TGACAGAGCTCAGGCAGAGTGGG + Intronic
951486746 3:23221447-23221469 TGAAAGAGCTGGGGGAAAATGGG - Intronic
955441719 3:58963101-58963123 TGACAGAGCTGGGGAAAAAAAGG + Intronic
960966959 3:123112170-123112192 TCACAGAGGTGCAGCACAAAGGG - Intronic
969733724 4:8973067-8973089 TGAGAGAGCAGCGGCATACTGGG + Intergenic
969793315 4:9507127-9507149 TGAGAGAGCAGCGGCATACTGGG + Intergenic
974964675 4:68746444-68746466 TAATAGAGCTGAGGCCCAATAGG + Intergenic
984113704 4:175651155-175651177 TGACAAAACTGAGGCACAGTGGG - Intronic
984606596 4:181792809-181792831 TTACAGAGATGCTGCTCAATAGG - Intergenic
986716038 5:10524317-10524339 CAACAGATCTGCAGCACAATAGG - Intergenic
986761237 5:10882050-10882072 GGACACAGCTGGGGCACAAGGGG - Intergenic
993756368 5:91735244-91735266 TGAGAAAGCTGCAACACAATTGG - Intergenic
999504624 5:152181858-152181880 TGGGATAGCTGAGGCACAATGGG + Intergenic
1000841604 5:166226108-166226130 TGACAGAACTGCTGCAAAATGGG - Intergenic
1002101631 5:176860809-176860831 TAACAGAGCTGCGGAACATGCGG + Intronic
1004011116 6:11688444-11688466 TGAGAAAGCTGAGGCACGATAGG + Intergenic
1004947264 6:20629727-20629749 TGACAGAGCTGCGGCACAATGGG - Intronic
1005013005 6:21353810-21353832 TGCCAGAGCTGTGGCACTTTGGG + Intergenic
1018672819 6:166193763-166193785 TGGCAAAGCTGCCCCACAATCGG - Intergenic
1019962843 7:4475505-4475527 TGACAGAGCTGTGCGACAAGGGG + Intergenic
1020307545 7:6846380-6846402 TGAGAGAGCAGCGGCATACTGGG - Intergenic
1021776033 7:24056295-24056317 TGAGATTGCTGCTGCACAATAGG - Intergenic
1022528151 7:31051698-31051720 TCACAGAGCTGTGGCACAGCAGG + Intergenic
1023575182 7:41619684-41619706 TGGCTGAGCTGAGGCACAAATGG - Intergenic
1026826722 7:73587096-73587118 TGCCAGGGCTGGGGCACACTTGG + Intergenic
1028742768 7:94295139-94295161 AGAGAGAGCTGTGGCACAGTGGG - Intergenic
1030556666 7:111033328-111033350 TGACAAAGATGTGGAACAATAGG + Intronic
1032351284 7:131166192-131166214 TGACAGAGCTTGGCGACAATTGG + Intronic
1037390614 8:18387645-18387667 CGAAAGAGCTGCGGCAAAAAGGG - Intergenic
1051365280 9:16317306-16317328 TGACAAAGCTGTGGAACATTTGG - Intergenic
1062137731 9:134938533-134938555 TGACAAAGCTGAGGCACTGTTGG + Intergenic
1192796636 X:74428998-74429020 TGCCAAAACTGCTGCACAATTGG + Intronic
1193382376 X:80830260-80830282 TGACACAGATGTGGCAAAATTGG + Intergenic
1195441166 X:104899973-104899995 TCACAGAGCTGCTGCATTATGGG + Intronic
1198081068 X:133239827-133239849 TCCCAGAGCTGTGGAACAATTGG + Intergenic
1198483878 X:137066897-137066919 TGACAAAGGTGTGGCACAATTGG + Intergenic
1199829045 X:151530764-151530786 TGACAGAGCTGAGGTATTATAGG - Intergenic