ID: 1004947265

View in Genome Browser
Species Human (GRCh38)
Location 6:20629728-20629750
Sequence GTGACAGAGCTGCGGCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004947265_1004947274 22 Left 1004947265 6:20629728-20629750 CCATTGTGCCGCAGCTCTGTCAC 0: 1
1: 0
2: 1
3: 5
4: 133
Right 1004947274 6:20629773-20629795 GAGATGCCCCATGTTCTTCTTGG No data
1004947265_1004947275 23 Left 1004947265 6:20629728-20629750 CCATTGTGCCGCAGCTCTGTCAC 0: 1
1: 0
2: 1
3: 5
4: 133
Right 1004947275 6:20629774-20629796 AGATGCCCCATGTTCTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004947265 Original CRISPR GTGACAGAGCTGCGGCACAA TGG (reversed) Intronic