ID: 1004947265

View in Genome Browser
Species Human (GRCh38)
Location 6:20629728-20629750
Sequence GTGACAGAGCTGCGGCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004947265_1004947275 23 Left 1004947265 6:20629728-20629750 CCATTGTGCCGCAGCTCTGTCAC 0: 1
1: 0
2: 1
3: 5
4: 133
Right 1004947275 6:20629774-20629796 AGATGCCCCATGTTCTTCTTGGG No data
1004947265_1004947274 22 Left 1004947265 6:20629728-20629750 CCATTGTGCCGCAGCTCTGTCAC 0: 1
1: 0
2: 1
3: 5
4: 133
Right 1004947274 6:20629773-20629795 GAGATGCCCCATGTTCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004947265 Original CRISPR GTGACAGAGCTGCGGCACAA TGG (reversed) Intronic
901625972 1:10625311-10625333 GCCACAGAGCTGTGGGACAAGGG - Intronic
905631175 1:39519371-39519393 GGAACAGAGCTGGGGCACAGAGG - Intronic
905666583 1:39766800-39766822 GGAACAGAGCTGGGGCACAGAGG + Intronic
906081639 1:43093682-43093704 ATGACAGAGCTGTGGCCAAAAGG + Intergenic
907332539 1:53680447-53680469 CTGACAGAGCTGTGTCACCATGG + Intronic
920073409 1:203319969-203319991 GAGACAGAGCTTCAACACAATGG + Intergenic
920076311 1:203339754-203339776 GAGACAGAGATGTGGCACATAGG - Intergenic
1069154519 10:65010757-65010779 GTGACACAGCTGTGGGACTATGG - Intergenic
1070226520 10:74513882-74513904 CTGATAGAGCTGCTGTACAAAGG - Intronic
1071721220 10:88148319-88148341 GTGATAGAGCTGAGGCCAAAGGG - Intergenic
1071857894 10:89644791-89644813 GTGAACGGGCTGCTGCACAACGG - Exonic
1072043275 10:91629950-91629972 GTGGCAGAGCTGGGGGAGAATGG - Exonic
1073153178 10:101325742-101325764 GTCACATAGCTTGGGCACAAGGG - Intergenic
1073550993 10:104401075-104401097 GTGACACAGCATGGGCACAATGG - Intronic
1075529365 10:123214913-123214935 GGGACAGGGCTGCGGATCAAGGG + Intergenic
1075670522 10:124261133-124261155 GTGACAGAGCTCGGACACAAGGG + Intergenic
1076070051 10:127482115-127482137 GTGGCAGAACTGAGGGACAATGG - Intergenic
1076112922 10:127874362-127874384 GGGACAGAGCTCCGGGACCAGGG + Intergenic
1077062542 11:624212-624234 GTGTCAGAGCGGAGGCACATTGG - Exonic
1083276988 11:61602504-61602526 ATGAGAGACCTGAGGCACAAAGG - Intergenic
1090044445 11:123318504-123318526 AGGACAGAGCTGGGGCACAGAGG - Intergenic
1092359861 12:7827516-7827538 CTGAGAGAGCTGGAGCACAATGG + Exonic
1092372600 12:7929705-7929727 CTGAGAGAGCTGGAGCACAATGG + Exonic
1093245855 12:16735620-16735642 CTGAGAGAGCTGGGGCATAAAGG - Intergenic
1098005578 12:65993531-65993553 CTGACAGAGCTAGGGGACAAGGG + Intergenic
1103516917 12:121514133-121514155 GTGACAGAGGTGGGACAAAAGGG - Intronic
1113524015 13:110959752-110959774 GGGACAAAGCCGCGACACAAAGG - Intergenic
1113578698 13:111413158-111413180 CTGACAGAGCTGCAGCTCATGGG + Intergenic
1118368296 14:65114313-65114335 ATGAGAGAGCAGCAGCACAAGGG - Intergenic
1119613631 14:76083994-76084016 GTGGCAGTGCTGCGTCACTAAGG - Intronic
1120707398 14:87758976-87758998 GCTACAGAGCTGAGGCAAAAGGG + Intergenic
1121064215 14:90946277-90946299 GGGGCAGGGCTGCAGCACAATGG - Intronic
1121164980 14:91786054-91786076 GTGACAGAGCTGGGGTGCCAGGG + Intronic
1121274078 14:92656158-92656180 GTGTAAGAGCTGAGGCCCAAAGG + Intronic
1122367507 14:101202882-101202904 GGGACAGGGCTTCGGCACAGTGG - Intergenic
1122604631 14:102939968-102939990 GTGACGGTGCTGCGGCACCAGGG + Intronic
1122953341 14:105058310-105058332 GTGACTGAGCTGCTGCACTCCGG + Intronic
1124622133 15:31279824-31279846 AGGACAGAGCAGCGGCACAGCGG - Intergenic
1124721164 15:32112046-32112068 GGGACAGAGCTGCTTCTCAAAGG - Intronic
1126098471 15:45105772-45105794 GTCCCATAGCTGCTGCACAAAGG + Exonic
1126892619 15:53222690-53222712 GTGAGAGAGCAGGGGAACAAAGG - Intergenic
1128112692 15:65086628-65086650 GTTACAGAGCTGGGGCCCATGGG - Intergenic
1129988406 15:79939589-79939611 GTGACAGAGAGGAGGCAGAATGG + Intergenic
1131495257 15:92904206-92904228 CTGTCAGCGCTGCGGCACAAAGG - Intronic
1133068823 16:3231840-3231862 GTGACAGAACTGAGGCAGAGAGG - Intronic
1134739268 16:16528210-16528232 GTGACAGAGTTGGGACACACAGG + Intergenic
1134928232 16:18183941-18183963 GTGACAGAGTTGGGACACACAGG - Intergenic
1136536629 16:30903367-30903389 GGGACAGGGCTGAGGCCCAAAGG - Exonic
1142110244 16:88327340-88327362 GTGGCAGGGGTGCTGCACAAAGG - Intergenic
1144340373 17:14304668-14304690 GGGACAGAGCGGAGGTACAATGG - Intronic
1144411889 17:15009686-15009708 GTGAGAGAGCTGCTGTAAAAGGG - Intergenic
1148149467 17:45388105-45388127 GTGAAAAAACTGGGGCACAAAGG + Intergenic
1159059456 18:63499591-63499613 GTGAGGGAGCTGAGGCACAGAGG + Intronic
1159719832 18:71874741-71874763 GTGAAAGAGATGCAGCATAATGG + Intergenic
1161346102 19:3769593-3769615 GGGACAGAAGTGCGGCACCAGGG - Exonic
1161746032 19:6060831-6060853 GTGACAGGGGAGGGGCACAAGGG - Intronic
1162014353 19:7836458-7836480 CAGACAGAGCTGCAGCACAGCGG + Intronic
1163527938 19:17832617-17832639 GTGAAACAGCTGCAGCACAGCGG - Exonic
1163895261 19:20052732-20052754 GGCAGAGGGCTGCGGCACAACGG - Intergenic
1164833137 19:31338370-31338392 GGGACAGAGCTCAGACACAAAGG + Intronic
1164878323 19:31709192-31709214 GTGGCAGAGCTGGGGTTCAAGGG - Intergenic
1168562221 19:57394036-57394058 GTCACAGAGCTGCAGCACTGAGG + Intronic
1168695437 19:58401399-58401421 GTAATAGGGCTGCGGCACTAAGG - Intergenic
927022970 2:19036610-19036632 CTGACAGAGATGGGGCAAAAGGG - Intergenic
927187534 2:20492410-20492432 GAGCCAGAGCTGCAGCCCAAGGG - Intergenic
927250293 2:20990386-20990408 GTGACAGAGGAGAGGCCCAAGGG + Intergenic
928375562 2:30770474-30770496 TTGACAGAGTTGAGGCAGAAGGG + Intronic
929005141 2:37386672-37386694 GGGACAGACCTGGGGTACAAAGG - Intergenic
931218768 2:60270295-60270317 GTGAAGGAGCTGGGGCACATTGG - Intergenic
932271301 2:70412504-70412526 GTGACAAAACTGAGGCCCAAAGG - Intergenic
932420222 2:71597104-71597126 GAGACAGGGCTTCCGCACAAAGG - Intronic
935874689 2:107494020-107494042 GTGACACAGCTGAGGGAAAAGGG + Intergenic
938131326 2:128717968-128717990 GAGACAGAGCTGAGGGACAGAGG + Intergenic
938570208 2:132555758-132555780 GACACAGAGCTGAGACACAAAGG + Intronic
940308579 2:152252974-152252996 GTGACAGAGTTGAGGCAGGAGGG - Intergenic
943399850 2:187394092-187394114 GTCAAAGAGATGCAGCACAAGGG + Intronic
946717368 2:222566685-222566707 GTGACAGAGATGCTGCAGACTGG + Intergenic
947166207 2:227264505-227264527 ATGACAGAGATGTGGCCCAATGG + Intronic
1168785828 20:539485-539507 GTGTCAGAGATGAGGCAGAAGGG - Intronic
1169298015 20:4416653-4416675 GTCAGAGAGCTGCAGCACCAGGG - Intergenic
1175724303 20:61307079-61307101 GAGACAGAGCAGCGGCTCAGAGG + Intronic
1178694584 21:34781820-34781842 GTGACAGAGGAGCTGCACACAGG + Intergenic
949372219 3:3347769-3347791 ATGACAGAGCTGAGTGACAATGG + Intergenic
950210343 3:11118407-11118429 GTGACAGAGCTGGGGTGCAGAGG - Intergenic
950498233 3:13347178-13347200 GAGACACAGCTGCGGCTCACAGG + Intronic
950882300 3:16332526-16332548 GTGACAGAGATGGGGAACTAGGG + Intronic
951486747 3:23221448-23221470 GTGAAAGAGCTGGGGGAAAATGG - Intronic
954063590 3:48088784-48088806 GAGACGGAGCTGGGGCAGAAGGG + Exonic
954367922 3:50155899-50155921 GAGAGAGAGCTGAGGCAGAAGGG - Intronic
960966960 3:123112171-123112193 CTCACAGAGGTGCAGCACAAAGG - Intronic
961742472 3:129041181-129041203 GTGACCGAGCTGGGACACATGGG - Intergenic
963953184 3:151225110-151225132 GTCACAGTGCTGGGGCAGAAAGG - Intronic
964011052 3:151892227-151892249 GAGACAGAGCTGAAGCATAAAGG + Intergenic
969104066 4:4791673-4791695 GGGACAGTGCTGCCACACAAAGG - Intergenic
969430383 4:7150517-7150539 AGGACAAAGCCGCGGCACAAGGG - Intergenic
971758810 4:30737090-30737112 GTGACAGAGCTGGGGCTAGAAGG - Intronic
972883737 4:43458604-43458626 CTGACAGAGCAGAGGCAGAAAGG - Intergenic
973087154 4:46079324-46079346 GAGACAGGGCTGAGGAACAAGGG - Intronic
977621210 4:99139840-99139862 GTGGCAGAGCTGGGGCTAAAGGG + Intronic
981915697 4:150030512-150030534 GTTACAGAGCTGGGGAAAAATGG - Intergenic
984771113 4:183436779-183436801 GACACAGTGCTGAGGCACAAAGG - Intergenic
986761238 5:10882051-10882073 CGGACACAGCTGGGGCACAAGGG - Intergenic
988083410 5:26442007-26442029 GTCACAGAGATGAGGCAGAAGGG + Intergenic
997906191 5:137819644-137819666 GTGGCAGAGCTGAGACACAGAGG - Intergenic
998535565 5:142927291-142927313 GTGACTGAGAAGGGGCACAAGGG - Intronic
998567300 5:143226903-143226925 GTGCCATACCTGCGGCTCAAAGG + Intronic
999246599 5:150158279-150158301 GGGCCAGAGATGCAGCACAAAGG + Intergenic
1000841605 5:166226109-166226131 ATGACAGAACTGCTGCAAAATGG - Intergenic
1002205976 5:177562764-177562786 GTGATGGAGCTGGGGCACAGAGG + Intergenic
1004324406 6:14661479-14661501 GTGAGAGAGCTGCGGCACCATGG + Intergenic
1004947265 6:20629728-20629750 GTGACAGAGCTGCGGCACAATGG - Intronic
1005380853 6:25232694-25232716 GAGACAGAGCTGCGGGGCAGGGG - Intergenic
1008704225 6:54138075-54138097 GGGACTGAGCTGGGGCACCAGGG - Exonic
1008890235 6:56479983-56480005 GTCACAGAGCTGCTTCACAGAGG - Intronic
1019962842 7:4475504-4475526 CTGACAGAGCTGTGCGACAAGGG + Intergenic
1027635732 7:80670399-80670421 GGGACAGAGCTTGGGCTCAAGGG - Intronic
1029724397 7:102392730-102392752 GTGACAGACCTGGGCCACTAAGG + Intronic
1031687296 7:124747113-124747135 GTGGCCGAGCTCCGGCAGAAAGG - Exonic
1031890955 7:127293053-127293075 ATGAGAAAGCTGAGGCACAAAGG - Intergenic
1036657195 8:10684290-10684312 GTGAAAGAGCTTTGGCAGAAGGG - Intronic
1037390615 8:18387646-18387668 GCGAAAGAGCTGCGGCAAAAAGG - Intergenic
1038213913 8:25544202-25544224 GAGACAGAGCAGGAGCACAAGGG + Intergenic
1040518161 8:48151190-48151212 GTGACAGGCCTGTGGCAAAAGGG + Intergenic
1040923753 8:52653625-52653647 GTGACAGAGTTTGGGCCCAATGG + Intronic
1045651678 8:104347329-104347351 GTTACAGAGCAGAGACACAATGG + Intronic
1045762155 8:105622606-105622628 CTGACAGAGATGCTGAACAAAGG + Intronic
1051907513 9:22113349-22113371 GTTACAGAGCTGTGACAGAAAGG - Intergenic
1057607966 9:96515140-96515162 ATGAGAGAGCTGCTGTACAATGG + Intronic
1057915472 9:99052143-99052165 GAGACAGAGCTGAGGCCTAATGG - Intronic
1059492668 9:114682072-114682094 GTCACAGAGCTGGGGAACCAGGG + Intergenic
1060755425 9:126208931-126208953 GTGACAGAGCTGGGATTCAAGGG - Intergenic
1060867870 9:127014104-127014126 GTGACAGAGCTGGGGAGCTAAGG + Intronic
1061489501 9:130937477-130937499 GTGACACTGCCGTGGCACAAGGG - Intronic
1188524277 X:31072142-31072164 GGGACAGAGTTGCGGGGCAAGGG + Intergenic
1189057276 X:37711363-37711385 GAGAAAGACCTGAGGCACAAAGG - Intronic
1190726999 X:53196252-53196274 GTGCAAGAGCTGTGGCAGAAGGG - Intronic
1192550329 X:72048439-72048461 GTGACAGAGCTCCTGTCCAATGG + Intergenic
1194720272 X:97332884-97332906 GTGACAGAGCTAGGGCAAAAAGG - Intronic
1195652147 X:107296206-107296228 GTGGCAGAGCAGCAGCTCAAGGG - Intergenic
1196185682 X:112742628-112742650 GAGACAGAGCTGAGGCAAAGGGG + Intergenic