ID: 1004947266

View in Genome Browser
Species Human (GRCh38)
Location 6:20629736-20629758
Sequence AGCACAGGGTGACAGAGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 438}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004947266_1004947274 14 Left 1004947266 6:20629736-20629758 CCGCAGCTCTGTCACCCTGTGCT 0: 1
1: 0
2: 3
3: 59
4: 438
Right 1004947274 6:20629773-20629795 GAGATGCCCCATGTTCTTCTTGG No data
1004947266_1004947275 15 Left 1004947266 6:20629736-20629758 CCGCAGCTCTGTCACCCTGTGCT 0: 1
1: 0
2: 3
3: 59
4: 438
Right 1004947275 6:20629774-20629796 AGATGCCCCATGTTCTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004947266 Original CRISPR AGCACAGGGTGACAGAGCTG CGG (reversed) Intronic
900195439 1:1373412-1373434 AGTACAGGGGGACAGGACTGGGG - Intergenic
901740692 1:11339917-11339939 ACCACAGTGTGACAGAGATGGGG - Intergenic
901767730 1:11514620-11514642 AGCCCAGCATGTCAGAGCTGGGG + Intronic
901863884 1:12091392-12091414 AGCTGAGGGTGAGGGAGCTGGGG + Intronic
902332725 1:15738439-15738461 AGCTCAGGGTGGCAGGGCTGGGG + Intronic
902876453 1:19343572-19343594 AGCTCGGGATGACAGAGCTTAGG + Intronic
903212083 1:21824120-21824142 GGCACCGGGTGACAGCACTGCGG - Exonic
903803915 1:25990570-25990592 AGCTCAGGAAGACAGACCTGGGG + Intronic
904283311 1:29436687-29436709 AGCACAGGGTAGCAGTGCTCTGG - Intergenic
904973194 1:34435047-34435069 CGCACTGGGTGACAGGGCTGGGG + Intergenic
905234005 1:36533177-36533199 AACACAGGGGGCCAGAGATGGGG - Intergenic
905314592 1:37073899-37073921 AGCACATGGTGACATAACTCAGG + Intergenic
906103762 1:43279524-43279546 CCCACAGGGTGCCCGAGCTGGGG - Intergenic
906415303 1:45617227-45617249 AGCACAGGGAGATAGGGTTGGGG - Intronic
906640318 1:47437583-47437605 AGCACAGGGTGCAGGAGCGGCGG + Exonic
907337357 1:53708804-53708826 AGCACACACTGGCAGAGCTGGGG + Intronic
907498527 1:54861377-54861399 AGGGCAGGGTGACAGAGCCTAGG - Intronic
909235094 1:73143038-73143060 AGCAAAGGGTGATAGGGATGGGG + Intergenic
912518802 1:110231689-110231711 AGGACACGCAGACAGAGCTGTGG - Intronic
912687647 1:111779682-111779704 ACCACAGGGTGACTGGGCAGGGG + Intronic
913115422 1:115692208-115692230 AGCACAGGGAGAGAGGGCAGTGG + Exonic
913244562 1:116860278-116860300 AGCAAAGGGAGATAGAGGTGGGG + Intergenic
914912823 1:151801054-151801076 AGCAGAGGGTCACTGAGGTGAGG + Exonic
915091701 1:153430607-153430629 TGCACAAAGTCACAGAGCTGGGG + Intergenic
915294167 1:154908524-154908546 ACCACAGGGTCCCAGAGCTCAGG + Intergenic
916055580 1:161067106-161067128 ACAACAGGGTCACAGAGATGGGG + Intronic
916267462 1:162905005-162905027 AGCACAGGGCGACAAAGTAGTGG - Intergenic
917438051 1:175040949-175040971 CACACAGGGAGACAGAGATGAGG - Intergenic
918734961 1:188048824-188048846 AGCAGAGGGAGAAAGAGCTATGG + Intergenic
919161862 1:193840607-193840629 TGCACAGAGTGCCAAAGCTGTGG - Intergenic
919341925 1:196321233-196321255 AAGACAGGGTGAGAGAGATGTGG - Intronic
922599407 1:226838279-226838301 AGCAAAGGGAGACAGGGGTGGGG - Intergenic
922714534 1:227860019-227860041 AGCACTGGGTGGCAAAGCAGAGG - Intergenic
922810253 1:228411319-228411341 ATCACAGGATGGCAGAGGTGGGG - Intronic
923956758 1:239031138-239031160 AGCAAAGGGAGACAGGGGTGGGG - Intergenic
924674523 1:246162003-246162025 AGGACAGCGTGGCAGAGCTGTGG + Intronic
924743718 1:246813484-246813506 AGCAAAGGGAGACAGGGGTGGGG - Intergenic
1064358382 10:14640535-14640557 AGCCCAGTGTGACCTAGCTGAGG + Intronic
1064799558 10:19053071-19053093 AGCAGAGGGTGGCAGGGCTGAGG - Intronic
1065047476 10:21757308-21757330 AGCCCAGGGTGTGACAGCTGTGG - Intronic
1067174165 10:43930795-43930817 AGGGAAGGGTGACAGAGCAGGGG + Intergenic
1068381650 10:56261756-56261778 AGAACAGGGTGAGAGAGCAGTGG - Intergenic
1068648984 10:59500601-59500623 AGCACTGGGAGACTGAGATGAGG + Intergenic
1069311224 10:67039977-67039999 AGGACAGGGTGACATTCCTGAGG - Intronic
1069318812 10:67142302-67142324 AACCCAGGGAGACAGAACTGTGG - Intronic
1069878942 10:71579861-71579883 AGCCCTGGGTGATGGAGCTGGGG + Intronic
1070637022 10:78137321-78137343 AGCACAGGGTGGCAGAGACTGGG - Intergenic
1070745190 10:78929536-78929558 AGCACAGGGACCCAGTGCTGGGG + Intergenic
1071187796 10:83063240-83063262 AGCAAAGGGAGACAGGGGTGGGG - Intergenic
1071319580 10:84440527-84440549 AGAACAGGTTGACTGAGGTGGGG - Intronic
1071697092 10:87887910-87887932 CTCACAGGATGAAAGAGCTGTGG + Intronic
1071778385 10:88814704-88814726 AGCACAAGGTGACAGATTTCAGG - Intronic
1073191092 10:101651124-101651146 ATCCCTGGGGGACAGAGCTGGGG - Intronic
1074891697 10:117741425-117741447 GGCCCAGGGTCCCAGAGCTGAGG + Intergenic
1075069247 10:119309653-119309675 TGCCCAGGGTCACAGAGCTATGG + Intronic
1076450565 10:130554505-130554527 AGCACAGGCTGTCAGTGATGAGG + Intergenic
1076869724 10:133187409-133187431 AGCTCACGGGGACACAGCTGGGG - Intronic
1077431457 11:2517823-2517845 AGCACAGGTTGACAGATCGCTGG - Intronic
1077922159 11:6649703-6649725 AGGGCAGGGTGAGGGAGCTGGGG + Intronic
1078048308 11:7938767-7938789 AGAACAGGGTCACAGATGTGAGG + Exonic
1078689133 11:13561503-13561525 AGCACAGGGAGACTGAGAGGTGG - Intergenic
1078692834 11:13598885-13598907 AGCACAGGGAGACTGAGAGGTGG + Intergenic
1079013248 11:16846927-16846949 AGTGCAGTGAGACAGAGCTGTGG + Intronic
1079085577 11:17442649-17442671 AGGAGAGGGTGTCAGAGCTCGGG - Intronic
1079645528 11:22860332-22860354 AGGACAGAGTGGCAGAGTTGAGG + Intronic
1079953195 11:26829972-26829994 AGCACAGGTTGGCAGAGTTATGG + Intergenic
1080114499 11:28606883-28606905 AGCTCCAGGTTACAGAGCTGAGG + Intergenic
1080879794 11:36308862-36308884 AGCACAGGGAGAAAGGGCAGTGG - Intronic
1081349667 11:42035116-42035138 AGCACAGGGTGACTGGAGTGTGG + Intergenic
1081488261 11:43547905-43547927 AGCCCAGGGAGCCCGAGCTGGGG - Intergenic
1081749601 11:45500563-45500585 AGCACAGGGAGACTGAGCGATGG - Intergenic
1083180628 11:60982514-60982536 GGCGCGGGGAGACAGAGCTGAGG + Intronic
1083624415 11:64064765-64064787 AGCAAAGGCTGACAGAACAGAGG + Intronic
1083658477 11:64241489-64241511 AGCAGAGGGGGACGGAGCGGAGG + Intronic
1083717166 11:64584088-64584110 AGCAAAGGGGGAGAGAGATGGGG - Intergenic
1083824408 11:65190354-65190376 AGCACAGGAGGACAGAGCAGCGG - Intronic
1084083144 11:66842479-66842501 AACAAAGGGAGACAGAACTGAGG + Intronic
1084590781 11:70088864-70088886 AGCACAGTGTTACAGAGCCACGG - Intronic
1084634830 11:70384859-70384881 AGCCCAGGGTGGCAGAGGGGAGG + Intergenic
1085270790 11:75268782-75268804 AGAAAAGGGTGACTGGGCTGAGG + Intronic
1085533460 11:77204774-77204796 TGTAGAGGGTGACACAGCTGGGG - Intronic
1085809714 11:79668901-79668923 GGCACAGCATGGCAGAGCTGGGG - Intergenic
1086405795 11:86497988-86498010 AGCACAGGGAGGCACTGCTGCGG + Exonic
1086729306 11:90228042-90228064 TGTACAGAGTGCCAGAGCTGAGG - Intergenic
1087105587 11:94403720-94403742 GCCAAGGGGTGACAGAGCTGTGG + Intergenic
1088812660 11:113401965-113401987 AGCATGGGGTGAGAGAGGTGGGG + Intergenic
1089067184 11:115670800-115670822 AGCACAGGCTGACAGTGTTTTGG - Intergenic
1089384493 11:118058964-118058986 AGAGCGTGGTGACAGAGCTGGGG + Intergenic
1089757362 11:120696527-120696549 GGCCCAAGGTGAGAGAGCTGGGG + Intronic
1090207885 11:124895946-124895968 AGGCCAGAGTGACAGAACTGAGG + Intronic
1091305900 11:134535922-134535944 GGCACAGGGCCACAGAGCTCCGG - Intergenic
1092124538 12:6066036-6066058 AGCCCAGGCTGACACATCTGTGG + Intronic
1092259713 12:6946368-6946390 AGCTCAAGCTGACAGAGCGGCGG - Intergenic
1092395546 12:8122412-8122434 AGCACAGGGAGTCAGAGCCTTGG + Intergenic
1093062116 12:14618038-14618060 AGCACTGGGAGACATGGCTGGGG - Intronic
1093245856 12:16735628-16735650 AGAACAAGCTGAGAGAGCTGGGG - Intergenic
1094583333 12:31754796-31754818 AGCACAAGGTGGCTGTGCTGGGG + Intergenic
1094749840 12:33393113-33393135 GCCACAAAGTGACAGAGCTGAGG + Intronic
1095132546 12:38561110-38561132 AACACAGGGTCTGAGAGCTGAGG + Intergenic
1095507988 12:42918507-42918529 AGCACCAGATGACAGAGCTCTGG - Intergenic
1095928048 12:47598733-47598755 AGCAGAAGTTGTCAGAGCTGGGG + Intergenic
1095953795 12:47795482-47795504 AGGACAGGGGGACAGAGATGGGG + Intronic
1096116689 12:49059497-49059519 AGAAGGGGGTGCCAGAGCTGGGG - Intronic
1097593458 12:61599839-61599861 AGCACAGGTTGACACACATGTGG - Intergenic
1097996329 12:65891729-65891751 AGCACAGGGCAGCAGAGTTGGGG - Intronic
1100354789 12:93818767-93818789 ACCACAGGGTGAGAGAACTGGGG + Intronic
1101764035 12:107682404-107682426 AGCCCTGAGTGACAGAGTTGTGG + Intergenic
1102499292 12:113340363-113340385 ATCTCAGGGTGCCAGTGCTGGGG + Intronic
1102600024 12:114022588-114022610 AGCAAAGGGAGATAGAGGTGGGG - Intergenic
1102661782 12:114535259-114535281 AGCACAAAGTGACAGAACTTTGG + Intergenic
1104376405 12:128267825-128267847 TCCACAGGGTGACTGTGCTGGGG - Intronic
1104970752 12:132529597-132529619 AGCCCAGGGTGGCAGAGCCCAGG - Intronic
1104970760 12:132529632-132529654 AGCCCAGGGTGGCAGAGCTTAGG - Intronic
1104987921 12:132607501-132607523 AGCACGGGGTGAGGGAGCCGAGG - Intronic
1105825636 13:24120130-24120152 AACAGAGGGAGACAGGGCTGAGG - Intronic
1109876966 13:68417472-68417494 AGCATAGGGTGTTAGAGCTCAGG - Intergenic
1110117403 13:71836783-71836805 AGGACAGAGTGAGAGAGCTTGGG - Intronic
1110411164 13:75205011-75205033 TGCACAGAGTGTAAGAGCTGAGG - Intergenic
1110829329 13:80012433-80012455 AGAAAAGCGTGACAGAGGTGGGG - Intergenic
1111708890 13:91785960-91785982 AGTAGAGAGTGACAGACCTGAGG - Intronic
1112142465 13:96660583-96660605 AACACAGGGTGAAAGCTCTGTGG + Intronic
1112744435 13:102510694-102510716 ACCACTGGATGTCAGAGCTGTGG - Intergenic
1113077351 13:106480167-106480189 AGCACAGGGGGAGAGATCTCTGG + Intergenic
1113311382 13:109136589-109136611 TGAACAGGGTGACATAGCTAAGG - Intronic
1115753968 14:36515716-36515738 AACACTGGGTGACAGGCCTGAGG - Intergenic
1117720578 14:58625102-58625124 AGCACAAGGAGAGAGGGCTGTGG + Intergenic
1117804978 14:59482214-59482236 AGCACAAGGTCACTGAGATGGGG + Intronic
1117901491 14:60538493-60538515 AGCACAGAGAGAAAGAGCTCTGG + Intergenic
1119163278 14:72471069-72471091 AGCACAGGCTGACCCAGATGGGG + Intronic
1119325336 14:73756734-73756756 ACCTCAGGGTGAAAGAGTTGTGG - Intronic
1119618317 14:76112953-76112975 ATCACAAGGTGGCAGAGATGAGG - Intergenic
1119859135 14:77924003-77924025 AGAACAGGGTGAGGGGGCTGAGG - Intronic
1120241363 14:81953288-81953310 AGTACAGAGTGCAAGAGCTGTGG - Intergenic
1120250880 14:82061005-82061027 AGCAAAGGGAGACAGGGGTGGGG + Intergenic
1120618710 14:86736938-86736960 AGCACAGGGAGATAGGGGTGGGG - Intergenic
1120791749 14:88590379-88590401 AGCACGGGGAGCCAGAGCAGAGG - Intronic
1121016349 14:90551719-90551741 AGCTCAGGAACACAGAGCTGAGG + Intronic
1121140730 14:91539391-91539413 TGCACAGAGTGAAAGAGTTGAGG - Intergenic
1121520322 14:94581651-94581673 AGCATAAGGTCACAGAGCTCGGG - Exonic
1122422519 14:101586623-101586645 AGCACAGTGTAACAGAGCTGGGG + Intergenic
1122654001 14:103244784-103244806 AGCACAACGGGACAGAGCAGCGG + Intergenic
1122987021 14:105217195-105217217 GGCACAGGGCGGCAGGGCTGGGG + Intronic
1125150279 15:36522998-36523020 TGCACAAGGTGCCAGAGCTATGG - Intergenic
1127811444 15:62568756-62568778 AGCTCAGGAGGACAGGGCTGGGG - Intronic
1128728131 15:70002750-70002772 AGCACAGGGATACAGGCCTGGGG + Intergenic
1129034003 15:72638988-72639010 AGCACAGGCTGAGAGCACTGAGG - Intergenic
1129215879 15:74098228-74098250 AGCACAGGCTGAGAGCACTGAGG + Intergenic
1129388240 15:75207466-75207488 GGCACAGGGGGGCAGTGCTGGGG - Exonic
1129408923 15:75338227-75338249 AGCACAGGCTGAGAGCACTGAGG - Intronic
1129733021 15:77942559-77942581 AGCACAGGCTGAGAGCACTGAGG + Intergenic
1130055739 15:80523835-80523857 TGTACAGGGTAACAGAGCAGTGG + Intronic
1130061856 15:80576170-80576192 AGCACAGGGTAACAGCGAAGAGG - Intronic
1130683087 15:86013707-86013729 GGCACAAGGTGGCAGAGGTGGGG - Intergenic
1130969392 15:88720338-88720360 AGCCCAGGGAGAAAGAGCCGTGG - Intergenic
1131995745 15:98131278-98131300 TCCAAAGGGTGAGAGAGCTGGGG - Intergenic
1132372887 15:101310224-101310246 TGCAGAGGCTGACAGTGCTGGGG - Intronic
1133463964 16:6012028-6012050 GGCACAGGGTAACAGCTCTGTGG - Intergenic
1133849025 16:9484626-9484648 AGGCAAGGGTGACACAGCTGTGG - Intergenic
1135040658 16:19114635-19114657 AGCGCAGGAGGACATAGCTGAGG - Exonic
1135090200 16:19508131-19508153 GGCACAGAGTGATAGAGCTGTGG - Intronic
1136067917 16:27771096-27771118 AGGACGGGGTGACAGGGCAGAGG - Intronic
1137547337 16:49413547-49413569 AGCAGAGGGTGACAGCACTATGG + Intergenic
1137720506 16:50625016-50625038 TGCCCAGGGTCACACAGCTGTGG + Intronic
1138527285 16:57616413-57616435 AGCACAAGATGTCAGAGCTGGGG + Intronic
1138693745 16:58792018-58792040 AAATCAGAGTGACAGAGCTGGGG + Intergenic
1139107996 16:63851533-63851555 ACCAGTGGATGACAGAGCTGGGG + Intergenic
1139359872 16:66390882-66390904 AGCTGAGGGTGAAGGAGCTGGGG + Intronic
1139823707 16:69740617-69740639 AGCACAGGGTACCAGAGGAGAGG - Intergenic
1140698151 16:77555624-77555646 GGCTCAAGGTGACAAAGCTGGGG - Intergenic
1141616952 16:85215179-85215201 ATCACAGGGTTTCAGAGCTGAGG - Intergenic
1141732571 16:85832880-85832902 AACAGAGAGTGACAGAGCTGCGG - Intergenic
1142109171 16:88322194-88322216 AGCCCAGCGTGTCAGAGCCGGGG + Intergenic
1142900019 17:3005913-3005935 AGCCGAGAGTGACAGACCTGAGG + Intronic
1143631573 17:8143198-8143220 AGCACAGGGTGGCAGAGGGGCGG + Intronic
1143802893 17:9399398-9399420 TGCGCAAAGTGACAGAGCTGAGG + Intronic
1144832391 17:18139057-18139079 TGCTCAAGGTCACAGAGCTGGGG - Intronic
1144857331 17:18276830-18276852 TGCCCAGGGTGACACAGCTTGGG - Intronic
1144937680 17:18913257-18913279 TGCACAGAGTGAATGAGCTGTGG - Intronic
1145004244 17:19328542-19328564 AGCAAAGAGGGACACAGCTGGGG - Intronic
1146177801 17:30677728-30677750 TGCAAAGGGTGAGGGAGCTGGGG - Intergenic
1146529046 17:33592249-33592271 AGCACTGGGACACAGAGCAGGGG - Intronic
1147266145 17:39236196-39236218 AGCACGGGGTGCCTGAGCTCTGG + Intergenic
1147609515 17:41793356-41793378 TGCACAGGCTGACACAGCTGGGG + Intergenic
1147752761 17:42746426-42746448 AGCACTGGGAGGCAGAGGTGGGG - Intergenic
1147913909 17:43875547-43875569 AGAACAGAGTCATAGAGCTGTGG + Intronic
1148459406 17:47830125-47830147 AGGACAGGGTGTCAGAGCAGCGG - Intronic
1148623460 17:49051932-49051954 AAGACAGGGAGACAGAGGTGGGG - Exonic
1148840404 17:50492407-50492429 TGCACAGGGTCACAGAGCTAGGG + Intergenic
1149598714 17:57879566-57879588 AGCACAGGGTGGCAGGGAAGAGG - Intronic
1151824021 17:76513538-76513560 ACCAAAGGCTGACAGAGGTGAGG + Intergenic
1151948025 17:77330014-77330036 AGCACAGGGAGCCCCAGCTGGGG - Intronic
1152359921 17:79827744-79827766 AACTCAGGGTGGCAGAGATGTGG - Intergenic
1152434536 17:80267616-80267638 CACACAGGCTGACAGAGTTGAGG + Intronic
1153193629 18:2569918-2569940 AGCAGAAGGTGGCAGGGCTGAGG - Intronic
1153463420 18:5362672-5362694 AGCAAAGGCAGACACAGCTGGGG - Intergenic
1153667333 18:7378012-7378034 TGCCCAGGGTTACAGAGATGTGG - Intergenic
1154247581 18:12713403-12713425 AGCACAGGGAGGCAGATTTGAGG - Intronic
1154467195 18:14658340-14658362 ATCACAAGGTGATAGACCTGGGG + Intergenic
1155742282 18:29303368-29303390 TGGACAAGGTGACAAAGCTGAGG - Intergenic
1156654763 18:39272130-39272152 AGCAAAGGGAGGCAGGGCTGCGG - Intergenic
1159609996 18:70514284-70514306 AGCCCAGGGTGTGAGAGCAGTGG + Intergenic
1159878238 18:73833681-73833703 GGCACAGAGTGGCAGAGATGTGG - Intergenic
1160269872 18:77373619-77373641 AGGACAAGGTGGCAGAGGTGGGG + Intergenic
1160609649 18:80075357-80075379 AGCACAGGGTCCCAGAGCACAGG + Intronic
1160609659 18:80075402-80075424 AGCACAGGGTCCCAGAGCACAGG + Intronic
1160609695 18:80075582-80075604 AGCACAGGGTCCCAGAGCACAGG + Intronic
1160609705 18:80075627-80075649 AGCACAGGGTCCCAGAGCACAGG + Intronic
1160609709 18:80075642-80075664 AGCACAGGGTCCCAGAGCACAGG + Intronic
1160609713 18:80075657-80075679 AGCACAGGGTCCCAGAGCACAGG + Intronic
1160609729 18:80075732-80075754 AGCACAGGGTCCCAGAGCACAGG + Intronic
1160609763 18:80075897-80075919 AGCACAGGGTCCCAGAGCACAGG + Intronic
1160609773 18:80075942-80075964 AGCACAGGGTCCCAGAGCACAGG + Intronic
1160609777 18:80075957-80075979 AGCACAGGGTCCCAGAGCACAGG + Intronic
1160981621 19:1818984-1819006 AGCACCGTGTGGCAGAGCAGGGG + Intronic
1161164450 19:2778599-2778621 AGCCCAGGGTGTCTAAGCTGGGG - Intronic
1161299944 19:3537715-3537737 AGAAGAGGGTGAAGGAGCTGGGG + Intronic
1161801265 19:6417873-6417895 AGCAGAGGGCAGCAGAGCTGCGG - Intronic
1162924442 19:13923210-13923232 AGAGAAGGGTGACAGAGCCGTGG + Intronic
1162946746 19:14048689-14048711 AGCTCAGGGGGACGGAGCTGGGG - Intronic
1162971509 19:14183705-14183727 AGGACAGGGAGACTGAGGTGGGG + Intronic
1162980688 19:14237520-14237542 TGCAAAGGGTGAGGGAGCTGGGG + Intergenic
1163136957 19:15318864-15318886 AGCACAGGCTGACAAAGTTGGGG + Intronic
1163186081 19:15640716-15640738 AGCTCAGGGTGACACAGCACAGG - Intronic
1163222989 19:15935006-15935028 AGCTCAGGGTGACACAGCATGGG + Intergenic
1164460446 19:28443225-28443247 AGCTCAGGGAGACAGATTTGAGG - Intergenic
1164807347 19:31127275-31127297 AGAACAGGGTGGAAGATCTGGGG - Intergenic
1165252631 19:34552981-34553003 ATCACAGGGTGACAGATGCGGGG + Intergenic
1166071796 19:40392398-40392420 AGCACGGGGAGAGAGAGGTGTGG + Intergenic
1166674622 19:44732404-44732426 AGGAAAGGCTGTCAGAGCTGGGG + Intergenic
1167090874 19:47342799-47342821 GGATCAGGGTAACAGAGCTGAGG + Exonic
1167169298 19:47820592-47820614 AGGACAGAGGGACAGAGATGAGG + Intronic
1167427635 19:49437561-49437583 AAAAGAGGGTGACAGAGATGGGG + Intronic
1167521665 19:49959278-49959300 GGCTCAGGGTCCCAGAGCTGAGG - Intronic
1167756349 19:51415816-51415838 GGCTCAGGGTCCCAGAGCTGAGG - Intronic
1167798849 19:51727409-51727431 AGCACAGGGTGGGAGAGGTAAGG + Intergenic
1168319756 19:55501690-55501712 AGCAGAGGGGGATGGAGCTGTGG - Intronic
925168267 2:1733078-1733100 AGCAATGGATGAGAGAGCTGTGG + Intronic
925920693 2:8635976-8635998 AGCACAGGGTGGCAGAGCCAGGG + Intergenic
926140946 2:10367750-10367772 AGTGGAGGGTGACAGAGCTTCGG + Intronic
926589169 2:14721237-14721259 AGCACCGGGAGACAGATTTGAGG + Intergenic
928405549 2:31011741-31011763 GGCAGAGGCTGGCAGAGCTGAGG - Intronic
929309533 2:40406627-40406649 AGATCAGTGTGGCAGAGCTGTGG + Intronic
929666691 2:43839026-43839048 AGCCCAGGGTCACAGACCTGTGG + Exonic
929720348 2:44361750-44361772 ACCAGAGGATGAGAGAGCTGTGG - Intronic
930752855 2:54949165-54949187 AGGACCTGGTGACAGGGCTGGGG - Intronic
932236233 2:70123418-70123440 AGCACAGGGAGCAAGAGATGGGG + Intergenic
932418782 2:71589180-71589202 AGCAGGGGGTGGCAGAGATGGGG + Intronic
933447304 2:82398377-82398399 AGCAAAGGGAGACAGGGGTGGGG + Intergenic
934504407 2:94879708-94879730 AGCCCAGGGTGGCTGGGCTGTGG - Intergenic
936152379 2:110028804-110028826 AGCAGAGAGTGCCAGAGCTGGGG + Intergenic
936192300 2:110342608-110342630 AGCAGAGAGTGCCAGAGCTGGGG - Intergenic
936870539 2:117130871-117130893 AGCAAAGGGAGACAGGGGTGGGG - Intergenic
937228955 2:120385691-120385713 ATCACAGTGAGACAGAGCAGAGG - Intergenic
938382402 2:130843967-130843989 AGGACAGGGACACAGAGGTGGGG - Intronic
938613108 2:132969511-132969533 ACCCCAGGGTGAGAGAGCTGAGG + Intronic
938625476 2:133104226-133104248 AGCACAGCGTCAAAGAGATGTGG + Intronic
939537372 2:143448412-143448434 AGCACAGAGTGAGAGATCAGAGG + Intronic
941528997 2:166641573-166641595 AGCAAAGGGAGACAGGGGTGGGG + Intergenic
941749073 2:169116545-169116567 AGCAGAGGGTGGCAGGGCTGAGG - Intergenic
942455550 2:176136019-176136041 AGCACAGGGTGAGAGATGGGAGG + Intergenic
942778656 2:179614643-179614665 AGCACAGATTGACAGTACTGAGG + Intronic
942913423 2:181273700-181273722 AGTTCAGGGAGACAGAGCTCTGG + Intergenic
943196575 2:184759892-184759914 AGCAAAGGGAGATAGAGGTGGGG - Intronic
943460442 2:188166078-188166100 AGCAAAGGGAGATAGAGGTGGGG + Intergenic
943526156 2:189020364-189020386 GGCACAGGGAGGCACAGCTGGGG + Intergenic
944581445 2:201136377-201136399 TGCACAGGCTGGCAGAGCTATGG + Intronic
944906877 2:204270567-204270589 AGCAAAGGAAGACAGAGGTGGGG + Intergenic
945025416 2:205615587-205615609 AGCTCAGGGTGGCAGATCTCCGG + Exonic
945812890 2:214569782-214569804 AGGAGAGGATCACAGAGCTGTGG - Intronic
945886397 2:215380514-215380536 ATCACAGGGAGTCAGAGCTTAGG + Intronic
945953587 2:216064164-216064186 AGCACAGAGTTACAAAGCTTGGG + Intronic
946340919 2:219067933-219067955 AGCACAGGGTGAAAGGATTGGGG + Intergenic
947913849 2:233819462-233819484 AGGACAAGGTGGCAGAGCCGCGG + Exonic
949009775 2:241671850-241671872 CCCACAGGGAGACAGAGATGAGG - Intronic
1168826947 20:820209-820231 AGCACCAGGTGCCAGGGCTGCGG + Intergenic
1169159069 20:3360989-3361011 AGCAGAGGGTGGCAGGGCTGAGG + Intronic
1169383277 20:5127085-5127107 TTCCCAGGATGACAGAGCTGAGG + Exonic
1170736255 20:19016248-19016270 ACCAATGGGGGACAGAGCTGGGG + Intergenic
1170901413 20:20466800-20466822 AGTACAGGGTGAGAGTGATGTGG - Intronic
1171207441 20:23292062-23292084 TGCACGGTGTGGCAGAGCTGAGG + Intergenic
1171904569 20:30891184-30891206 AGCACTGGGTGATGGAGCTAAGG - Intergenic
1171953425 20:31441248-31441270 AACCCAGGGTGACACGGCTGTGG + Intronic
1172109663 20:32537536-32537558 GGTACAGAGTGACAGAGCTGGGG + Intronic
1172130233 20:32650388-32650410 AGGACAGGCAGGCAGAGCTGGGG + Intergenic
1173168222 20:40701019-40701041 AGCTCAGGGTGCCAGAACTGGGG - Intergenic
1173306585 20:41856352-41856374 GACAAAGGGTGAGAGAGCTGAGG + Intergenic
1174201299 20:48808433-48808455 AGCACAGGAGGACAAAGCAGGGG + Intronic
1174330619 20:49814436-49814458 AGCACAGTGTGAAAGAGCTGTGG + Intronic
1174370194 20:50081865-50081887 AGCAGAGGGTGGCAGGGCTGAGG + Exonic
1175124701 20:56742634-56742656 AGGACGGAGGGACAGAGCTGAGG + Intergenic
1175215549 20:57390241-57390263 AGCACAGGGCGACGCAGGTGGGG - Intergenic
1175418850 20:58818655-58818677 AGCACATGTGGACAAAGCTGTGG + Intergenic
1176807320 21:13499339-13499361 ATCACAAGGTGATAGACCTGGGG - Intergenic
1178039959 21:28629307-28629329 AGCCAAGGGAGACAGTGCTGTGG + Intergenic
1178525026 21:33320465-33320487 ACCACAGGGTGTCACAGCTGTGG + Intergenic
1178942173 21:36915165-36915187 AGCTGATGGTGGCAGAGCTGAGG - Intronic
1179732743 21:43376551-43376573 GGGACTGGGTGACAGAGCGGAGG - Intergenic
1179967092 21:44813581-44813603 AGGACAGGGTGACAGCGGCGTGG + Intronic
1180102560 21:45595938-45595960 AGCAGAGGCTGACAGCGCAGGGG + Intergenic
1180337990 22:11597321-11597343 AGCACTGGGTGATGGAGCTAAGG - Intergenic
1180695371 22:17748619-17748641 CGCCCAGGGCCACAGAGCTGGGG - Intronic
1180960015 22:19758335-19758357 GGCACAGAGGCACAGAGCTGAGG + Intronic
1181491286 22:23262376-23262398 AGCACAGGGTGGCAGAGGGAGGG - Intronic
1181937306 22:26448174-26448196 AGCACAGGGAGAAGGACCTGGGG - Intronic
1182735532 22:32530071-32530093 AGCAAGGGGTGACAGTGCCGTGG - Intronic
1182962491 22:34488677-34488699 AGCAAAGGGTGACGCTGCTGTGG - Intergenic
1183364964 22:37402028-37402050 AGCCCAAGGTCACACAGCTGTGG - Intronic
1183605765 22:38866109-38866131 AGCACAGGGAGAGAGGGCTGGGG + Exonic
1183729626 22:39610740-39610762 AGCACAGACTAGCAGAGCTGTGG - Intronic
1184080301 22:42214643-42214665 AGCAGAGGATGGCAGAGTTGAGG + Exonic
1184103511 22:42354128-42354150 AGGACAGGGAGACAGAGAGGAGG - Intergenic
1184803532 22:46776945-46776967 GGCACAGGACGACAGAGCTGAGG + Intronic
1184966845 22:47981637-47981659 CTCACAGGTTCACAGAGCTGGGG - Intergenic
1185271706 22:49932644-49932666 AGCCCAGGCTGACAGTGCAGTGG + Intergenic
1185326313 22:50227486-50227508 AGCAGAGTGTGGCAGCGCTGAGG - Intronic
949188962 3:1228337-1228359 AGCACAGGAAGAAAAAGCTGAGG + Intronic
949577960 3:5357314-5357336 AGCACAGGAAGACAGAGTAGGGG - Intergenic
950167728 3:10814478-10814500 AGCACATGGGGACAGAGGTTTGG + Intergenic
950646149 3:14378009-14378031 TGCACAGGGTGCCAGACCCGTGG - Intergenic
950842106 3:15977667-15977689 AGCTCAGGTTGTCAGAGCAGAGG - Intergenic
952302693 3:32117975-32117997 TGTACAGGCTGACAGAGGTGTGG + Intronic
952841665 3:37651851-37651873 AAGCCAGGGTGACAGAGGTGAGG + Intronic
952997507 3:38899215-38899237 AGTACAGTGTGACAGAGCCCAGG - Intronic
953815589 3:46153631-46153653 AGCACAGGGTGGCAGAACCAAGG + Intergenic
953833904 3:46326840-46326862 AGCAAAGGGAGATAGAGGTGGGG + Intergenic
954131459 3:48563207-48563229 AGGGCAGAGTGACAGAGCGGGGG + Intronic
954444097 3:50537382-50537404 GGCACAGGGTGTCAGAGGAGGGG - Intergenic
954593427 3:51803881-51803903 GGCAGAGAGTGGCAGAGCTGAGG + Intergenic
954612602 3:51953988-51954010 AGCACAAGGTGCAGGAGCTGAGG + Intergenic
955821676 3:62902375-62902397 AGCATAAGGTGACAGATCTGGGG - Intergenic
955919365 3:63939348-63939370 AGTACAGGGTGAAAGACATGGGG - Intronic
956489192 3:69753271-69753293 TGCACAGAGTGCAAGAGCTGGGG + Intronic
957027084 3:75194086-75194108 TGCACAGGGAGAGAGAGCTCTGG + Intergenic
960142271 3:114162703-114162725 AGTACAGGGAGACAGAGCATTGG + Intronic
960612811 3:119570542-119570564 AGAAGTGGGGGACAGAGCTGGGG - Intergenic
961332678 3:126152184-126152206 ACCAAAGGCTGACAGAGGTGGGG + Intronic
962783816 3:138746911-138746933 AGCACCTGCTGACATAGCTGCGG + Intronic
963481976 3:145887441-145887463 AACACAAGGTCACAGAGCTGTGG - Intergenic
964914562 3:161824423-161824445 AGCACAGGGTGACACTGATGTGG - Intergenic
965268570 3:166582349-166582371 AACACATGCTGACAAAGCTGTGG - Intergenic
965668049 3:171117197-171117219 AGCACATGGTGAGAAAGGTGGGG + Intronic
966055240 3:175678955-175678977 AGCAAAGGGAGACAGGGATGGGG + Intronic
966875634 3:184320201-184320223 AGAATAGGGTGCCAGAGCTGGGG + Intronic
967866900 3:194197784-194197806 AGCACGTGGTGACAGTGCTGGGG + Intergenic
968628681 4:1639132-1639154 AGCAATGGGAGACAGGGCTGTGG - Intronic
968856786 4:3131067-3131089 GACACAGGGTCACAGGGCTGTGG - Intronic
968919711 4:3516167-3516189 AGCCCAGGGTGATTGACCTGTGG - Exonic
968922638 4:3530648-3530670 AGCACCGGGGGACAGTGCAGGGG + Intronic
969047321 4:4345876-4345898 AGCTCCGGGTGGCAGAGCTGGGG + Intergenic
969262515 4:6043050-6043072 AGCACAGGGTGGCTGCCCTGTGG + Intronic
969434984 4:7183926-7183948 ACCACAGGGTCAAAGAGTTGAGG + Intergenic
969589711 4:8114852-8114874 AGCTCATGGTGCCAGTGCTGTGG + Intronic
969657247 4:8505399-8505421 AGGTCAAGGTGGCAGAGCTGGGG - Intergenic
969948320 4:10807405-10807427 AGCACATGGAGAGAGAGCTATGG - Intergenic
971540637 4:27812070-27812092 GGCACTGGGTGTCAGAGTTGTGG - Intergenic
971543359 4:27851346-27851368 TGCCCAGGGTCACAGAGCTACGG + Intergenic
973217072 4:47681319-47681341 AGCACAGGGAGCCAGGGCAGAGG + Intronic
973656706 4:53055590-53055612 CCCACAGGTTGACAGATCTGAGG + Intronic
974016015 4:56649980-56650002 AGCACAGGAGAACAGAGCTTGGG - Intronic
974610393 4:64208798-64208820 TGCACAGAGTGTAAGAGCTGTGG + Intergenic
975186896 4:71413979-71414001 CTCACAGAGTAACAGAGCTGTGG + Intronic
975250533 4:72173483-72173505 AGCAAAGGGAGACAGGGGTGGGG - Intergenic
977171432 4:93767552-93767574 AGCACGGGGCACCAGAGCTGAGG + Intronic
978303529 4:107295895-107295917 AGCACATGTTGACAAAGATGTGG - Intergenic
979146301 4:117252384-117252406 AGCAAAGGGAGATAGAGGTGGGG - Intergenic
979688458 4:123537535-123537557 AGCTCATGGTGACAGACCTGGGG + Intergenic
980126210 4:128776788-128776810 AGCACTGGGAGAGTGAGCTGAGG - Intergenic
980301925 4:131006963-131006985 AGAACAGGGTGAGAGTTCTGTGG - Intergenic
980340246 4:131535142-131535164 AGCACAGGGTGATAGGCCTCAGG - Intergenic
981589074 4:146337060-146337082 AGCCCAGGGCAACAGAGATGTGG + Intronic
982223086 4:153141305-153141327 TGCCCAGGGTCACAGAGCAGTGG - Intergenic
982319516 4:154063678-154063700 AGCAAAGGGAGATAGAGGTGAGG - Intergenic
982506024 4:156218881-156218903 CGCACAGAGTGTAAGAGCTGAGG + Intergenic
983085723 4:163441999-163442021 AGCACAGTGTAACTTAGCTGTGG - Intergenic
983124896 4:163938702-163938724 ATCACAGTTTCACAGAGCTGGGG + Intronic
984929461 4:184833977-184833999 AGTACAGGGTGGCACAGCTCTGG - Intergenic
985647180 5:1090432-1090454 AGGAGAGGGTGACGGGGCTGGGG + Intronic
986514164 5:8543163-8543185 AGGACAGGGCCACAAAGCTGGGG + Intergenic
987514264 5:18885872-18885894 AGCAGAGGGTGGCAGGGCTGAGG + Intergenic
987536812 5:19200214-19200236 AGCTCAGGGTGGCACAGCAGCGG - Intergenic
987841753 5:23231450-23231472 AGAACAGGGTGAGAGTTCTGTGG - Intergenic
989036466 5:37177886-37177908 AGCCCAGTGTGACAGAGTGGAGG - Intronic
989568652 5:42925177-42925199 AGCACATCCTGACAGGGCTGGGG - Intergenic
992002153 5:72446288-72446310 AGCACAGGGTGAGACACCTTAGG - Intronic
992167310 5:74067465-74067487 AGGACAGGGTGACAGGGAAGGGG - Intergenic
992381989 5:76246776-76246798 AGGGGAGGGTGACAGAGGTGGGG - Intronic
992768711 5:80027441-80027463 AGTCCAGGGGGAGAGAGCTGTGG - Intronic
994723193 5:103403909-103403931 TGAACTGGGTGACAGAACTGAGG + Intergenic
997216161 5:132112829-132112851 TGGACATGGTGACATAGCTGTGG - Intergenic
997237289 5:132280200-132280222 GGCACAGGGTGACAGGACTGAGG - Intronic
997264342 5:132486357-132486379 AGCACATGGCGACAGTGCTGGGG + Exonic
997608747 5:135195418-135195440 AGGGCAGTGTGACATAGCTGTGG + Intronic
997783371 5:136682701-136682723 CTCTCAGGGTGTCAGAGCTGCGG + Intergenic
997878185 5:137567607-137567629 ATCACAAGGACACAGAGCTGAGG - Intronic
998818901 5:146040846-146040868 AGCAGAGGGAGTCAGAGCTTCGG - Intronic
1000316229 5:160094673-160094695 AGCAAACAGTTACAGAGCTGTGG + Intronic
1001435827 5:171698612-171698634 GCCACATGGTGACAGAGTTGGGG + Intergenic
1002632221 5:180589944-180589966 AGTGCAAGGTGACAGAGATGGGG - Intergenic
1002853809 6:1020418-1020440 TGCAGAGGGAGACACAGCTGAGG + Intergenic
1003590207 6:7431133-7431155 AGCACAGGGTCAGTGAGCTTGGG + Intergenic
1004114873 6:12757227-12757249 AGCAGAGTGAGAGAGAGCTGAGG + Intronic
1004947266 6:20629736-20629758 AGCACAGGGTGACAGAGCTGCGG - Intronic
1006173770 6:32109789-32109811 AGCACTGGGTGATAGACATGGGG - Intronic
1006211953 6:32403230-32403252 GGCTCTGGGTGTCAGAGCTGTGG - Intronic
1006443781 6:34067769-34067791 AGCACAAGGAGACAGTGCTCCGG + Intronic
1007955007 6:45909891-45909913 AGCCCAGAGTGACTGATCTGGGG - Intronic
1008466738 6:51839977-51839999 AGCACAAGAAGACAGAGCTGGGG - Intronic
1009394219 6:63178581-63178603 AGGACAGGGTAACAAAGCTGGGG - Intergenic
1013154528 6:107480857-107480879 AGCAGAGAGTAAAAGAGCTGTGG - Intergenic
1013443005 6:110190713-110190735 AGCTCAGGGGGACCGAGCTAGGG + Intronic
1013581293 6:111537039-111537061 AGGCCAGAGTGCCAGAGCTGAGG + Intergenic
1013940245 6:115652376-115652398 AGCACAGGGAGACAGATTTGAGG + Intergenic
1015507808 6:134007347-134007369 AGGTCAGGGGGAGAGAGCTGAGG - Intronic
1015843738 6:137497242-137497264 AGCAGAGGGTGACCGAGGAGCGG - Intergenic
1017201692 6:151761522-151761544 TGCTCAGGGTCACAGGGCTGAGG - Intronic
1017270428 6:152497044-152497066 AGCAAAGGGAGACAGAGGTGGGG - Intronic
1018629076 6:165806459-165806481 AGCACAGCGTGAAATAGTTGAGG - Intronic
1019053813 6:169205616-169205638 AGCAGAAGGGGTCAGAGCTGAGG - Intergenic
1019364851 7:628017-628039 ATCACAGGGGGACAGCGGTGGGG + Intronic
1019511244 7:1418703-1418725 AGCACAGGGTGCCAGTCCTTAGG - Intergenic
1019542941 7:1559650-1559672 AGCAGGGGGTGACAGGGATGGGG + Intronic
1019752799 7:2743042-2743064 AGAACAAGAGGACAGAGCTGGGG + Intronic
1020285710 7:6678589-6678611 TGAACAGGGTGGCAGGGCTGAGG + Intergenic
1021854199 7:24837799-24837821 ACCACTGAGTGGCAGAGCTGGGG + Intronic
1021918131 7:25455819-25455841 AGAACTGAGTGAAAGAGCTGTGG - Intergenic
1022415119 7:30170813-30170835 CTCACATGGTGACAGAGCTGGGG + Intergenic
1022789214 7:33670144-33670166 ACCACAGGGAGACAGTGCTTGGG - Intergenic
1023247607 7:38222012-38222034 AACACAGGATGACAGGGCTGTGG - Intronic
1023588394 7:41755012-41755034 TGCACAGGGTTTCTGAGCTGTGG - Intergenic
1024697076 7:51868536-51868558 AGCAAAGGGAGATAGGGCTGGGG - Intergenic
1024731952 7:52262851-52262873 ACCACAGTATGACAGTGCTGGGG - Intergenic
1024960599 7:54970767-54970789 AGCACAGGGCGACAGAGACAGGG + Intergenic
1025101472 7:56138867-56138889 ACCACTAAGTGACAGAGCTGGGG + Intergenic
1026326365 7:69314183-69314205 AGCACAAGGTAACAGACCAGTGG + Intergenic
1026614015 7:71885796-71885818 ACCACAGGAAGAGAGAGCTGGGG - Intronic
1027000860 7:74653264-74653286 AGCCCACGGTGACAGAACGGTGG - Intergenic
1028113515 7:86971777-86971799 AGCTAAGGGTAACAGAGATGGGG + Intronic
1028148163 7:87341553-87341575 AGCAGAGAGTGGCAGGGCTGAGG - Intergenic
1029557908 7:101283102-101283124 AGCACCAGGTGCCAGAGCTGCGG + Intergenic
1031296353 7:120009505-120009527 AGCACAGGGAGATAGGGGTGGGG - Intergenic
1032336208 7:131027356-131027378 AGGACAGGGAACCAGAGCTGGGG - Intergenic
1032489650 7:132314569-132314591 AGGAAAGGGTGGGAGAGCTGAGG + Intronic
1033001688 7:137512227-137512249 TGCACAGGGTTACATTGCTGTGG - Intronic
1034474061 7:151272770-151272792 AGCACAGGGGGACACAGCAATGG + Intronic
1034483292 7:151340381-151340403 AGCTCAAGGAGACAGAGCTGAGG - Intergenic
1034991780 7:155551996-155552018 AGCACACGGTGTCTGAGCTAGGG + Intergenic
1035216628 7:157372444-157372466 AGCACAGCGGGCCAGAGCTGGGG + Intronic
1035659448 8:1335860-1335882 AGCAAAGTGTGGCAGAGCCGGGG + Intergenic
1036070418 8:5436568-5436590 AGCAAAGGGAGATAGAGGTGGGG + Intergenic
1036409362 8:8484511-8484533 AGCACAAAGTGACAGAGATATGG - Intergenic
1037834674 8:22208940-22208962 AGCACAGGGTCACAAACCGGAGG + Intronic
1039404887 8:37303994-37304016 CGCACAGGGAGAAAGTGCTGGGG + Intergenic
1040661730 8:49582795-49582817 TGCACAGGAGGGCAGAGCTGCGG - Intergenic
1041205241 8:55492937-55492959 AGCACAGCCTTACAAAGCTGTGG + Intronic
1041662537 8:60413629-60413651 CGCGCAGGGTGACAGGGCTGAGG + Intergenic
1043103880 8:76083284-76083306 TGCACAGAGTGCAAGAGCTGTGG - Intergenic
1045036117 8:98177861-98177883 AGGACAGGCTGACCGAGGTGAGG + Intergenic
1046257339 8:111718692-111718714 AGCACAAAGTGACACAGCTGGGG - Intergenic
1046479115 8:114791676-114791698 AGCAAAGCGTCACTGAGCTGCGG + Intergenic
1047706726 8:127506695-127506717 AGGACAGGATGATGGAGCTGAGG + Intergenic
1048328134 8:133454143-133454165 AGCACAGAGTGACAGGGAGGCGG + Intergenic
1049151386 8:141037530-141037552 AGCAGAGGGTGACAGGGAAGCGG + Intergenic
1049327512 8:142030933-142030955 ACCACAGGGTGGCCCAGCTGCGG - Intergenic
1049975836 9:860894-860916 AGCACAGGGTGACACCAGTGGGG + Intronic
1050896582 9:10890583-10890605 AGCAAAGGGAGATAGAGATGGGG - Intergenic
1053258625 9:36641474-36641496 ATCACAGGGAGACAGACCTCAGG + Intronic
1055798674 9:80005885-80005907 AGCACATGGAGACAGAGAAGAGG + Intergenic
1056343380 9:85663025-85663047 AGCACAGGGAGACAGAACCTAGG + Intronic
1058001522 9:99870650-99870672 ACCAGAAGGAGACAGAGCTGTGG - Intergenic
1058001554 9:99870884-99870906 AGCAAAGGATGAAAGGGCTGGGG - Intergenic
1058007806 9:99938233-99938255 AGCACAGGGAGAGAGAGCCCTGG - Intronic
1060113401 9:120922641-120922663 AGCACCGTTTGACAGAGCTCAGG + Intronic
1060819846 9:126654974-126654996 AGGACTGGGTGTCACAGCTGTGG - Intronic
1062014981 9:134286861-134286883 TCCAGAGGGTGGCAGAGCTGGGG - Intergenic
1062159262 9:135070671-135070693 AGCTCAGGATCTCAGAGCTGGGG + Intergenic
1062163574 9:135093652-135093674 GGCTCAGGGTCACAGAGCTACGG - Intronic
1062197833 9:135284539-135284561 AGCCCAGGCTGCCAGGGCTGTGG + Intergenic
1062462341 9:136667160-136667182 AGGACTGGCTGTCAGAGCTGAGG + Intronic
1062575796 9:137206983-137207005 AGCTCAGGGTGGCCAAGCTGAGG + Intronic
1185515642 X:697082-697104 AGCAAAGGGAGATAGAGGTGGGG + Intergenic
1185889176 X:3809244-3809266 AGCAAAGGGAGACAGGGGTGGGG - Intergenic
1185961722 X:4552171-4552193 AGCACAGGAAAACAGAGCGGTGG + Intergenic
1188552368 X:31378050-31378072 AGCAAAGGGAGACAGGGGTGGGG - Intronic
1189279423 X:39810721-39810743 AGCACAAGGTGACATGGGTGAGG + Intergenic
1189918527 X:45880719-45880741 ATCACATGGTGAGAGAGCAGAGG - Intergenic
1190155944 X:47992579-47992601 GGCACGGGGGGACAGACCTGTGG - Intronic
1191656323 X:63602965-63602987 AGAAAGGGGTGACAGACCTGGGG - Intergenic
1191902723 X:66055776-66055798 ATCACAGGGTGAGAGATCAGAGG + Intergenic
1191991552 X:67042095-67042117 AGCAGGCAGTGACAGAGCTGAGG - Intergenic
1192191608 X:68994542-68994564 ATCACAGGTTGGCAGGGCTGGGG - Intergenic
1193871592 X:86805200-86805222 AGCACAGAGTGCAAGAGCTGAGG - Intronic
1194148128 X:90288644-90288666 AGCAGAGGGTGGCAGGGCTGAGG + Intergenic
1195707790 X:107750576-107750598 AGAACAAGGAGAGAGAGCTGGGG + Intronic
1197047034 X:122010055-122010077 AGCAGAGGGTGATTGAGCTGAGG + Intergenic
1197960217 X:131996129-131996151 ACATCAGGGTGATAGAGCTGAGG - Intergenic
1198048621 X:132927262-132927284 AGCCCAGGGAGACAGGGTTGTGG - Intronic
1199681690 X:150229127-150229149 AGCACTGGGTGACTGAACTGAGG - Intergenic
1200098281 X:153674205-153674227 AGCCCAGGGTGGCAGAGCTGTGG - Exonic
1200204826 X:154308360-154308382 AGGCCAGGGTGCCAGAGCAGTGG + Intronic
1200494513 Y:3865415-3865437 AGCAGAGGGTGGCAGGGCTGAGG + Intergenic
1201307752 Y:12565072-12565094 AGCAAAGGGAGATAGAGGTGGGG + Intergenic