ID: 1004947269

View in Genome Browser
Species Human (GRCh38)
Location 6:20629751-20629773
Sequence CTACAGGGGGCAACCAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004947269_1004947280 20 Left 1004947269 6:20629751-20629773 CCTGTGCTGGTTGCCCCCTGTAG 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1004947280 6:20629794-20629816 GGGCTCTGAGACCCTGTGCTGGG 0: 1
1: 0
2: 5
3: 48
4: 360
1004947269_1004947279 19 Left 1004947269 6:20629751-20629773 CCTGTGCTGGTTGCCCCCTGTAG 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1004947279 6:20629793-20629815 TGGGCTCTGAGACCCTGTGCTGG No data
1004947269_1004947274 -1 Left 1004947269 6:20629751-20629773 CCTGTGCTGGTTGCCCCCTGTAG 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1004947274 6:20629773-20629795 GAGATGCCCCATGTTCTTCTTGG No data
1004947269_1004947275 0 Left 1004947269 6:20629751-20629773 CCTGTGCTGGTTGCCCCCTGTAG 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1004947275 6:20629774-20629796 AGATGCCCCATGTTCTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004947269 Original CRISPR CTACAGGGGGCAACCAGCAC AGG (reversed) Intronic
900678924 1:3905470-3905492 CTTCAGGGAGCCACCAGCATGGG + Intergenic
900753898 1:4419939-4419961 ATAGAGGGGGCCACCAGCTCAGG + Intergenic
903123995 1:21235572-21235594 TTCCAGGGGGCACACAGCACGGG + Intronic
904002638 1:27347657-27347679 GTACTGGGGGCAGCCAGGACTGG - Intronic
904434101 1:30483121-30483143 CTCCAGGGGACACCCAGCATGGG + Intergenic
904516512 1:31059984-31060006 CTACAGGCGCCCACCACCACGGG + Intronic
904632018 1:31849400-31849422 CTGCAGGTGGCCTCCAGCACTGG - Intergenic
907665753 1:56432728-56432750 CCAGAGGAGGCAACCAGCACAGG - Intergenic
909756723 1:79235464-79235486 CTACAGGAGGCAAGCACAACAGG - Intergenic
915127941 1:153678954-153678976 CTACAGGGGGCCTCGAGCCCCGG + Exonic
915407796 1:155674684-155674706 CTACAGGCGGGCACCACCACGGG - Intronic
917165585 1:172108843-172108865 CCACAGGGGCCATCCATCACAGG - Intronic
917224337 1:172765540-172765562 CTTCAGTGGACAAGCAGCACTGG - Intergenic
918736538 1:188071323-188071345 CTACATTGGGCAACCTGCAGAGG + Intergenic
919130988 1:193450234-193450256 CTACAGGAGGCAGCAAGAACAGG - Intergenic
922732129 1:227954132-227954154 CCTCAGGCGGCATCCAGCACAGG + Intergenic
1065633476 10:27706910-27706932 ATACAGGGTGCATACAGCACGGG - Intronic
1066061717 10:31729720-31729742 CTACAGTGGGCAACTATAACTGG + Intergenic
1066178727 10:32938980-32939002 GTGCAGGGGGCACCCAGTACCGG - Intronic
1067082874 10:43221525-43221547 CTACCCAGGGCAACCAGCACAGG + Intronic
1073512354 10:104050692-104050714 CTACAAGGGACAACCAGGAAGGG + Intronic
1074087949 10:110222902-110222924 CTCCAGGAGGCAGCCAGCGCAGG + Intronic
1074133987 10:110611022-110611044 GGACAGGAGGCATCCAGCACGGG + Intergenic
1076352908 10:129831182-129831204 CTACAGCTGGCACCCAGCAAGGG - Intergenic
1076694410 10:132240231-132240253 CTGCAGGTGGCGAGCAGCACTGG - Intronic
1081702741 11:45162174-45162196 CTAGAGGGGGCAGGCAGCAGAGG + Intronic
1084151654 11:67290324-67290346 CTGCAGGAGGCAGTCAGCACTGG + Exonic
1092689335 12:11089390-11089412 CTACAGGGGGAAACCACAGCTGG - Intronic
1095844902 12:46733982-46734004 GTACAGGAAGCATCCAGCACAGG + Intergenic
1095941493 12:47730073-47730095 CTACAAGGGGCAGCCACCACAGG + Intergenic
1101951402 12:109179038-109179060 CTTCATGGGGAAACCAGCTCTGG - Intronic
1102677308 12:114667556-114667578 CTCCAGGGCGCAGCCAGGACTGG + Intergenic
1104838264 12:131806714-131806736 ATACAGGTGCCAATCAGCACAGG + Intergenic
1105541615 13:21321193-21321215 CTCCTGGGGGCAGCCAGCCCTGG + Intergenic
1107758219 13:43648906-43648928 ATACAGGTTGCAGCCAGCACAGG - Intronic
1111313674 13:86522708-86522730 ATACAGAGGGGAACAAGCACTGG + Intergenic
1116278062 14:42862240-42862262 GAACAGGAGGCATCCAGCACGGG + Intergenic
1119324856 14:73753799-73753821 GTCCAGAGGGCACCCAGCACAGG + Intronic
1132335700 15:101047021-101047043 CTCCAGGGGGAACCCCGCACTGG + Intronic
1132500059 16:281129-281151 CTTCAGGAGGCCACCAGCCCGGG + Intronic
1132769239 16:1551813-1551835 CAACACAGGGCAACCAGCCCGGG - Intronic
1146160953 17:30559361-30559383 CGACAGGGGGCGGCCAGAACAGG - Exonic
1146282336 17:31552758-31552780 CTACCAGGGGTAACCAGCATGGG - Intergenic
1147848122 17:43419712-43419734 CTACAGGCGCCCACCACCACCGG + Intergenic
1152062842 17:78091566-78091588 CTCCAGGGGGGAAGCGGCACTGG - Exonic
1159174410 18:64814751-64814773 CTACAGGGGGAAAACAGCTGGGG + Intergenic
1159422029 18:68233844-68233866 CTACAGGGGACAACCATCACTGG + Intergenic
1161592893 19:5136700-5136722 CTTCAGTGGGCCATCAGCACTGG + Intronic
1164918081 19:32067875-32067897 CTCCAGGGGGCACCCCGAACAGG + Intergenic
1166417277 19:42605012-42605034 CTACAGGACACAACCAGCCCAGG - Intronic
1167485470 19:49760458-49760480 CTACAGGCGCCCACCACCACAGG + Intronic
925673418 2:6335530-6335552 GTGCAGGAGGCATCCAGCACGGG + Intergenic
932093055 2:68823761-68823783 CTGCAGGGGGCAAACAGAAGCGG + Intronic
934512180 2:94954279-94954301 CCTCAGGGCGCACCCAGCACAGG - Intergenic
944810418 2:203322223-203322245 CTACAGGTGCCCACCACCACAGG + Intergenic
944868058 2:203881463-203881485 GGACAGGGAGCAGCCAGCACGGG - Intergenic
945523742 2:210862367-210862389 CTACATGGGGCTACAAGCAGAGG - Intergenic
946791261 2:223302629-223302651 AGACAGGAGGCATCCAGCACAGG - Intergenic
1175162931 20:57022196-57022218 TTCCAGGGGGCAACCTGCCCGGG + Intergenic
1175367562 20:58466594-58466616 CCACAGCGGGCACCTAGCACGGG - Intronic
1175381582 20:58567730-58567752 CTACAGGGGGCAGGAGGCACAGG - Intergenic
1175880393 20:62254631-62254653 CTTGAGGGGTCACCCAGCACTGG + Intronic
1176106929 20:63393822-63393844 CTGCAGGGAGCATACAGCACAGG + Intergenic
1181166244 22:20984767-20984789 GTTCAGGGGGCACCCAGCACAGG + Intronic
1181171667 22:21013446-21013468 CTACAGGGGGCTACCACATCTGG - Intronic
1182075185 22:27490732-27490754 CAACAGGGAGCATACAGCACTGG + Intergenic
1185117020 22:48943841-48943863 CGTCATGGGGTAACCAGCACAGG + Intergenic
950108950 3:10406207-10406229 CATCAGGGGGCATCCAGCCCAGG + Intronic
953996138 3:47521497-47521519 CTACAGGATGCATCCAGGACGGG - Intergenic
955263821 3:57422365-57422387 CTACAGGCGCCCACCACCACGGG + Intronic
957959070 3:87226848-87226870 CTCCAGGGGCCAACAATCACCGG + Intergenic
959295496 3:104530094-104530116 CTCCAGGGGGCCAACAGCAATGG + Intergenic
960360568 3:116706014-116706036 CTACAGGTGCCCACCACCACAGG + Intronic
961564439 3:127753712-127753734 CTACAGGGGGCAAGAAGAGCAGG + Intronic
961822447 3:129582093-129582115 CAGCAGGGGGCTTCCAGCACTGG - Intronic
968000381 3:195201655-195201677 CTAGAGGGGCCAGCCAGCATGGG - Intronic
975666742 4:76740913-76740935 CTGAAGGGGGCATCCAGCAGGGG - Exonic
976151023 4:82091983-82092005 CTACACGTGGGAACCAGAACTGG + Intergenic
977605860 4:98984552-98984574 CTCCAGGGGTGAACCAGCATGGG - Intergenic
977982471 4:103340749-103340771 CTACAGGAAGCGACAAGCACAGG + Intergenic
981570426 4:146145431-146145453 CTACAGAGGACAGCCACCACTGG - Intergenic
983535591 4:168853693-168853715 CTACAGGGGGCGACCAGGCCTGG + Intronic
986774537 5:11001977-11001999 CTCCATGGGGCAAGAAGCACTGG - Intronic
994501170 5:100580493-100580515 CGACAGGAAGCATCCAGCACAGG + Intronic
994723916 5:103412424-103412446 CTACAGGAGGCATCCACCTCAGG + Intergenic
995832982 5:116374086-116374108 CGGCAGGAAGCAACCAGCACAGG - Intronic
997639532 5:135439622-135439644 CAACATGGAGCAGCCAGCACTGG - Intergenic
999932809 5:156452090-156452112 CTACATGGGGTGACCAGCACAGG - Intronic
1000323648 5:160155446-160155468 ATACAGGTGACAACCAGCATGGG - Intergenic
1002183226 5:177442113-177442135 CTCCTGGGGGCAGCCAGCCCTGG + Exonic
1004947269 6:20629751-20629773 CTACAGGGGGCAACCAGCACAGG - Intronic
1006045037 6:31287997-31288019 CTACAGGATGCTCCCAGCACAGG - Intronic
1006315173 6:33287254-33287276 ATACAGAGGGCAATCAGGACTGG - Intronic
1006418566 6:33919530-33919552 CTAGAGGGGGCAACAGGCAGAGG + Intergenic
1006888455 6:37402115-37402137 CCAGAGGCGGCAACAAGCACAGG - Intergenic
1010498736 6:76568036-76568058 CTACAGGTGTCCACCACCACGGG + Intergenic
1014220470 6:118794116-118794138 GGGCAGGGGGCATCCAGCACGGG - Intergenic
1015213430 6:130722544-130722566 CTACAGGGTGCAACCAGAAATGG + Intergenic
1019136083 6:169908509-169908531 CTCCAGGGTGCAACCTGCTCTGG - Intergenic
1028534881 7:91880980-91881002 CTACAGGGGGCATCCACTGCCGG + Intergenic
1045064680 8:98434982-98435004 CTCCTGGGGGCAACGATCACTGG + Intronic
1049080411 8:140438597-140438619 CTGCTCGTGGCAACCAGCACAGG + Intronic
1049437543 8:142594710-142594732 CTGCAGTGGGCACCCAGCCCAGG + Intergenic
1061156340 9:128864024-128864046 CTCCACGGGGCACCTAGCACAGG - Intronic
1062036742 9:134385830-134385852 CTACAGTGGGCAGCCAGCTGTGG + Intronic
1062577183 9:137214232-137214254 CTCCAAGAGGCACCCAGCACGGG + Exonic
1062703367 9:137919766-137919788 CAACAGCGGGCAGCCAGGACCGG + Intronic
1186139414 X:6555272-6555294 CGGCAGGGAGCATCCAGCACGGG - Intergenic
1188981613 X:36731967-36731989 CTAGAGGGAGCATCCAGCACAGG - Intergenic
1192555142 X:72083138-72083160 CTGTAGGGGGGAACCAGCAACGG - Intergenic
1195268292 X:103205455-103205477 CTACAGGTGCCCACCACCACGGG - Intergenic