ID: 1004947274

View in Genome Browser
Species Human (GRCh38)
Location 6:20629773-20629795
Sequence GAGATGCCCCATGTTCTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004947262_1004947274 28 Left 1004947262 6:20629722-20629744 CCCATCCCATTGTGCCGCAGCTC 0: 1
1: 0
2: 1
3: 4
4: 81
Right 1004947274 6:20629773-20629795 GAGATGCCCCATGTTCTTCTTGG No data
1004947263_1004947274 27 Left 1004947263 6:20629723-20629745 CCATCCCATTGTGCCGCAGCTCT 0: 1
1: 0
2: 3
3: 11
4: 223
Right 1004947274 6:20629773-20629795 GAGATGCCCCATGTTCTTCTTGG No data
1004947264_1004947274 23 Left 1004947264 6:20629727-20629749 CCCATTGTGCCGCAGCTCTGTCA 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1004947274 6:20629773-20629795 GAGATGCCCCATGTTCTTCTTGG No data
1004947269_1004947274 -1 Left 1004947269 6:20629751-20629773 CCTGTGCTGGTTGCCCCCTGTAG 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1004947274 6:20629773-20629795 GAGATGCCCCATGTTCTTCTTGG No data
1004947266_1004947274 14 Left 1004947266 6:20629736-20629758 CCGCAGCTCTGTCACCCTGTGCT 0: 1
1: 0
2: 3
3: 59
4: 438
Right 1004947274 6:20629773-20629795 GAGATGCCCCATGTTCTTCTTGG No data
1004947268_1004947274 0 Left 1004947268 6:20629750-20629772 CCCTGTGCTGGTTGCCCCCTGTA 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1004947274 6:20629773-20629795 GAGATGCCCCATGTTCTTCTTGG No data
1004947265_1004947274 22 Left 1004947265 6:20629728-20629750 CCATTGTGCCGCAGCTCTGTCAC 0: 1
1: 0
2: 1
3: 5
4: 133
Right 1004947274 6:20629773-20629795 GAGATGCCCCATGTTCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004947274 Original CRISPR GAGATGCCCCATGTTCTTCT TGG Intronic
No off target data available for this crispr