ID: 1004950716

View in Genome Browser
Species Human (GRCh38)
Location 6:20668107-20668129
Sequence CAGGATACACAATTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004950716_1004950720 -7 Left 1004950716 6:20668107-20668129 CCTTCCTCCAATTGTGTATCCTG 0: 1
1: 0
2: 1
3: 14
4: 197
Right 1004950720 6:20668123-20668145 TATCCTGGAATAATTCCATATGG No data
1004950716_1004950722 6 Left 1004950716 6:20668107-20668129 CCTTCCTCCAATTGTGTATCCTG 0: 1
1: 0
2: 1
3: 14
4: 197
Right 1004950722 6:20668136-20668158 TTCCATATGGATATATACAAAGG 0: 1
1: 0
2: 0
3: 29
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004950716 Original CRISPR CAGGATACACAATTGGAGGA AGG (reversed) Intronic
903469786 1:23578433-23578455 GAGGATACACAAGGAGAGGAGGG - Intergenic
905287910 1:36896003-36896025 CAGGATACAGAATTATAGGTTGG - Intronic
905342769 1:37290644-37290666 GAGGGTACAAAAATGGAGGAAGG - Intergenic
905380214 1:37556667-37556689 CAGGTGACAAAATTGGAGCATGG + Intergenic
905706116 1:40059943-40059965 CAGGATACAGAACAGGAGTAAGG - Intronic
910670768 1:89770576-89770598 CAGGATACAGCATTAGAGAAAGG - Intronic
911228721 1:95336813-95336835 CAACATTTACAATTGGAGGATGG - Intergenic
911242436 1:95480690-95480712 AAGGAAACACAATTTGAAGATGG - Intergenic
912073414 1:105842020-105842042 CAAGAAACACAAGAGGAGGAGGG + Intergenic
912547392 1:110460802-110460824 AAGGATACACAAATGAAGGAAGG - Intergenic
913463935 1:119119118-119119140 AAAGATACAGAATGGGAGGATGG + Intronic
915449776 1:155996557-155996579 GAGGTTATACACTTGGAGGAAGG - Intronic
917056189 1:170984541-170984563 CAGGATACTGGAGTGGAGGATGG - Intronic
917263945 1:173199452-173199474 CAAGATACACATTTGAAAGAAGG + Intronic
919002729 1:191854217-191854239 CTGCATACAAAATTGGAGGACGG - Intergenic
919571733 1:199257310-199257332 CAAGATACAGAATTGCAGAATGG - Intergenic
919641359 1:200047974-200047996 GACGACACACACTTGGAGGAAGG + Intronic
921233550 1:213099100-213099122 AAGGATACACAAGTAGAGAATGG + Intronic
922937856 1:229434809-229434831 CAGGATAGACAACTGGCGGGGGG + Intergenic
922942360 1:229478587-229478609 CAGGATAACCAATTAAAGGAAGG + Intronic
1064086058 10:12347805-12347827 AAGGAAACACAGTGGGAGGAAGG + Intergenic
1065603137 10:27390096-27390118 CAGGATACAAAATTCTAGGTTGG + Intergenic
1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG + Exonic
1070556823 10:77534347-77534369 CAGCATACAAAATTGGCAGAGGG + Intronic
1072280842 10:93863854-93863876 CAGGATAAAGAATGGGAAGAAGG - Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1078018985 11:7639956-7639978 CACAATCCACAATTGGAGAATGG + Intronic
1080901713 11:36499896-36499918 CAGGACAAAAAATTGGATGAAGG - Intronic
1082582431 11:54888995-54889017 CAGGATAAAAAATAGAAGGAAGG + Intergenic
1084938859 11:72601663-72601685 CAGGAGACACAAGAAGAGGAAGG + Intronic
1085305210 11:75481937-75481959 TAGGACACACAATTGGGGGCAGG + Intronic
1088800671 11:113303980-113304002 AAGGATATGCAATTTGAGGAAGG + Intergenic
1089353467 11:117834687-117834709 CAGGTTACACAGCTGGGGGATGG - Intronic
1090145946 11:124322766-124322788 CAGGATAGAGAATGGAAGGATGG - Intergenic
1090694252 11:129221622-129221644 CAGTATTCACCATTGCAGGATGG - Intronic
1091352605 11:134909120-134909142 CAGGAAACACAAATGAAAGATGG - Intergenic
1092482217 12:8870196-8870218 CAGGAAACACAGTTAGATGATGG - Intronic
1092822793 12:12368819-12368841 CATAATACACAAGTGGAAGATGG - Intronic
1093350620 12:18095617-18095639 CAGGATCCCCAAATGGTGGAGGG - Intronic
1094114067 12:26891098-26891120 TAGGATATACAATTGAAGGTTGG + Intergenic
1094868557 12:34571128-34571150 CAGGATAAAAAATAGAAGGAAGG - Intergenic
1098750748 12:74291547-74291569 CAAGATACAGTTTTGGAGGATGG - Intergenic
1100959757 12:99949392-99949414 CAGGATCAACATTTGGAGAATGG + Intronic
1101619888 12:106375089-106375111 CAGAATACACAAATCGAGGTTGG + Intronic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1103707042 12:122881248-122881270 CAGGAAACACAATCTTAGGAAGG + Intronic
1107355173 13:39558772-39558794 CAGGATACCCTATTTTAGGAAGG + Intronic
1109718157 13:66244326-66244348 CAGGATACTCTATTGGACCAAGG + Intergenic
1111509215 13:89238862-89238884 CAGGAGACAAAATTGAATGAAGG + Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113563502 13:111302913-111302935 AAGGATACACATTTGGGGAAAGG + Intronic
1118898064 14:69963571-69963593 GAGGATACGCCATTGGGGGAGGG - Intronic
1119644165 14:76336578-76336600 CAGGAAAGACAATAGAAGGAAGG - Intronic
1121283123 14:92713721-92713743 CAGCACCCACAGTTGGAGGACGG + Intronic
1121311937 14:92940088-92940110 CAGGATGCCCACTTTGAGGAGGG - Exonic
1121320471 14:92988929-92988951 GAGGCCACACAATTGGCGGAGGG + Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1126378745 15:48023832-48023854 CAGGAGCCACAACTGGAGGCAGG + Intergenic
1127697945 15:61470272-61470294 CAGGAGACACAATAGCAGAAAGG + Intergenic
1128318689 15:66677879-66677901 CAGGGGACACATTTGGAGGTTGG + Intronic
1128719136 15:69933202-69933224 CAGCATCCACAATTTGAGAAGGG - Intergenic
1129664828 15:77573715-77573737 CAGGAGCCAGAAGTGGAGGATGG + Intergenic
1136409406 16:30067374-30067396 CAGGAGACAGAATGGGTGGAGGG + Intronic
1137305536 16:47195988-47196010 CTGGATACAGAATTGTAGGTTGG + Intronic
1138237079 16:55393151-55393173 CAGGAATGACAATTTGAGGAAGG + Intronic
1138528528 16:57622428-57622450 CAGGAGCCACACTCGGAGGAGGG + Intronic
1140843784 16:78867062-78867084 AAGTATTCACAATTGGAGAAGGG + Intronic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1142735935 17:1899597-1899619 CAGGAAACAGAAGTGGGGGAGGG - Intronic
1143054449 17:4152359-4152381 CAGGATACATCAGTGGATGAAGG + Intronic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1144654281 17:17025382-17025404 CAGGAAACACCAATAGAGGAGGG + Intergenic
1149807341 17:59631171-59631193 CAGGATACACAATATAAGGGAGG - Intronic
1150642802 17:66961017-66961039 CAGGTTTCACACCTGGAGGATGG - Intergenic
1151124997 17:71835031-71835053 CATGAGACAGATTTGGAGGAAGG + Intergenic
1151315852 17:73322111-73322133 CAGGACACGCATGTGGAGGAGGG - Intergenic
1152093228 17:78258274-78258296 CAGGACACACCAAAGGAGGAGGG - Intergenic
1153050689 18:900803-900825 CAGGAAAAACAATTCGGGGAAGG + Intergenic
1155004587 18:21716872-21716894 AAGGATACAGAATTGCAGAATGG + Intronic
1155366692 18:25056207-25056229 CAGGATAGAAAATCAGAGGATGG - Intergenic
1155864678 18:30950623-30950645 CATGACACACAGTTGGAGGTAGG - Intergenic
1155925841 18:31653767-31653789 CAGGTAACACACTTGGAGAAAGG - Intronic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1156089431 18:33448056-33448078 CAGGATACAGAATTCTAGGTTGG - Intergenic
1156453209 18:37278387-37278409 CACAATACCCAACTGGAGGACGG - Intronic
1156821675 18:41380345-41380367 CCGGATACAATATTGGAGGAGGG + Intergenic
1156945335 18:42822651-42822673 CAGGATGCACAGTTTTAGGAAGG - Intronic
1157073369 18:44436419-44436441 CAGGATACAGAATTCTAGGTTGG + Intergenic
1158071711 18:53478098-53478120 AAGGATACAGAATTGGGGCAAGG + Intronic
1159828831 18:73248636-73248658 CAGGATTTACAATTGAATGAAGG + Intronic
1160187777 18:76688806-76688828 CAGCAGACACACTAGGAGGATGG - Intergenic
1160535918 18:79591379-79591401 CAGGGTACAGAATTGTAGGTTGG - Intergenic
1163071882 19:14849781-14849803 AAGGATACACAATTGTAGTTAGG - Intergenic
1163894815 19:20049452-20049474 CAGGAAAAACTAGTGGAGGATGG + Intergenic
1164546275 19:29166293-29166315 GATGATACATAAATGGAGGAGGG + Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
925799404 2:7583262-7583284 CAGGAGAAAGAATGGGAGGAAGG + Intergenic
926434548 2:12824697-12824719 CAGGAGAGACACTTTGAGGAGGG - Intergenic
926706226 2:15839667-15839689 CAGGATAAACAAATGGTGCATGG + Intergenic
927149824 2:20189120-20189142 CAGGTTACACAGTGGGAGGCAGG + Intergenic
934673725 2:96234411-96234433 CAGGAGACAGGAATGGAGGAGGG - Intergenic
936676116 2:114716822-114716844 AAGGATCCACTATTTGAGGAAGG + Intronic
937211013 2:120271007-120271029 CAGGACACAGAATTTTAGGAGGG + Intronic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
939002886 2:136756604-136756626 TTGGATACAGAATTGGAGCATGG + Intergenic
939121778 2:138125898-138125920 CATGACTCACAATTAGAGGATGG + Intergenic
944430285 2:199625909-199625931 AAGAATACAGGATTGGAGGAAGG + Intergenic
944458579 2:199920371-199920393 CAGGTTCCACGATTAGAGGAAGG - Intronic
945564456 2:211379540-211379562 CAGGATATAAAAATGTAGGATGG - Exonic
946217751 2:218198805-218198827 CAGGATACACTGTTGGAGTCAGG + Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
1170022962 20:11856058-11856080 CAGGATACAGAATTCTAGGTTGG - Intergenic
1173709147 20:45139233-45139255 CTGGATACACACTGGGACGAGGG - Intergenic
1173718125 20:45229457-45229479 CTGGATACACAGTGGGAAGAGGG + Intergenic
1175253086 20:57621519-57621541 CAGGAAACACAATTGGGGAATGG - Intergenic
1176974785 21:15308160-15308182 CAGGCCACAAAATTTGAGGAAGG + Intergenic
1178977387 21:37231613-37231635 CAGAATAAAGAATTAGAGGAAGG + Intronic
1180829810 22:18899042-18899064 CAGGATACAGAATTTTAGGTTGG + Intergenic
1183921863 22:41176291-41176313 CAGGATCAACAATGGGAGGCAGG - Exonic
1184335660 22:43851680-43851702 CAGGCTGCACACTTGGAGGGTGG - Intronic
1203279901 22_KI270734v1_random:124315-124337 CAGGATACAGAATTTTAGGTTGG + Intergenic
952484780 3:33799008-33799030 CAGGTTACAGGATTGAAGGAAGG - Intronic
956068838 3:65426066-65426088 AAGGACACACAATTGGAAGAGGG + Intronic
956125528 3:66007817-66007839 AAAGATACTAAATTGGAGGAGGG + Intronic
957175554 3:76803418-76803440 GAGGATACAAAAGAGGAGGAAGG + Intronic
958139520 3:89543401-89543423 CAGGATAGCCAACTGGAGGATGG + Intergenic
958493279 3:94806246-94806268 CAGGATACAAAAACAGAGGAAGG + Intergenic
959827365 3:110814557-110814579 GAGGCTACACAATTTGAGGTAGG + Intergenic
960319384 3:116215774-116215796 CAGGATACACCATGGTAGGCGGG + Intronic
960454829 3:117858214-117858236 CAGGTTAGACCATTGGAGAAAGG - Intergenic
961562400 3:127739832-127739854 CTGCATGCACACTTGGAGGATGG - Intronic
962047732 3:131778290-131778312 AAGGGTACACGATAGGAGGAGGG - Intronic
962165857 3:133047022-133047044 CAAAATAGACAATTAGAGGATGG + Intronic
965069094 3:163894219-163894241 CAAGGTACACAATGGGAGGAGGG + Intergenic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
966439273 3:179925993-179926015 CAGGAGAAACATTTGGAGGGGGG - Intronic
968589856 4:1451962-1451984 CAGGAGACATAAGTGGGGGAGGG - Intergenic
969216962 4:5730689-5730711 CAGGATCCACGCCTGGAGGAAGG + Intronic
969624538 4:8295597-8295619 CAGGAGACACAATGGCAGGAGGG - Intronic
969629085 4:8324943-8324965 CAGGATGCACAGCTGGAGGGTGG + Intergenic
970406094 4:15765796-15765818 CAGGATAAAGACTTGGGGGAAGG - Intergenic
971926281 4:33013150-33013172 CAATAGACAAAATTGGAGGAGGG + Intergenic
972703076 4:41513450-41513472 CCGGATACACAAATGGGGCAAGG - Intronic
973313399 4:48733313-48733335 CAGGATACAGAATTCTAGGCTGG - Intronic
973574249 4:52270155-52270177 CAGAATTCAAAATTGGAGTAAGG + Intergenic
974480249 4:62433545-62433567 AAGGATGCACAACTGGAGGATGG + Intergenic
975021199 4:69491578-69491600 CATGATAAACAATTAGAGAATGG + Intronic
976297302 4:83485086-83485108 CAGGCTACACAAGAGGACGAGGG + Exonic
980639328 4:135555039-135555061 CATTATACAGAATTGGAGGAAGG - Intergenic
982486347 4:155970001-155970023 CAGGATATATGATTAGAGGATGG + Intergenic
983515530 4:168652264-168652286 AAGGATATAAAAATGGAGGAAGG + Intronic
985337940 4:188915975-188915997 CAGGATATTTAATTGGAGGCAGG - Intergenic
986762647 5:10894347-10894369 CGGGAAACAGAATTGGATGATGG + Intergenic
988839950 5:35073741-35073763 TAGGATACAAAATTCAAGGAGGG + Intronic
992262754 5:74987362-74987384 CATAATACACAATTGTAGTAGGG - Intergenic
993445622 5:88008880-88008902 CAGCATACAAATTTGGAGAAGGG + Intergenic
994581494 5:101648438-101648460 CAGGCTGCACAATAGGAGGTGGG - Intergenic
999172698 5:149608739-149608761 CAGGTTACACAACTGGGGAAGGG + Intronic
1000412893 5:160952203-160952225 CAGGAAAATCAAGTGGAGGAGGG + Intergenic
1001930319 5:175668351-175668373 CAGAATTCTCAACTGGAGGAAGG - Intronic
1003250233 6:4421820-4421842 CTGGATACATAATTGTAGGTTGG - Intergenic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1005626448 6:27666947-27666969 CGGGAAACACAATTGAAGGTGGG + Intergenic
1006887672 6:37395987-37396009 TAAGATACACACTTGGTGGAAGG + Intergenic
1007915226 6:45555227-45555249 CCCGAAACACAATTGGATGATGG + Intronic
1008222223 6:48868932-48868954 CAGGATAAACAATTAGGAGAGGG + Intergenic
1009259354 6:61464264-61464286 CAGGATAAACACTAGAAGGAAGG + Intergenic
1009260868 6:61485623-61485645 CAGGATAAAAAATAGAAGGAAGG - Intergenic
1010917656 6:81640932-81640954 CATGATATACCATGGGAGGAAGG + Intronic
1011394807 6:86895049-86895071 AAAGATACAGAATTGGAGAATGG + Intergenic
1015059936 6:128951017-128951039 CAGGATAGAGAAGGGGAGGAAGG + Intronic
1015346386 6:132164326-132164348 CAGGATCAACAATTGGGGAATGG - Intergenic
1017852791 6:158319779-158319801 CAGAATACACAATGTGAGAAAGG - Intronic
1018640935 6:165903510-165903532 CAGAAAAGACAATTGGAGGAAGG + Intronic
1021219430 7:17958903-17958925 CAGGTTTCACATTTGGAAGAGGG - Intergenic
1022074023 7:26947886-26947908 CATGATACAAGATTGGAGAAAGG - Intronic
1022102334 7:27175869-27175891 CTGGATTCACACTGGGAGGAAGG - Intronic
1022419773 7:30209565-30209587 TTGGATACACAATTGGAGTCAGG + Intergenic
1026497727 7:70918317-70918339 CAGTATAGATAAGTGGAGGATGG + Intergenic
1028100149 7:86809345-86809367 CATGATCCACAATTGTATGATGG - Intronic
1028929955 7:96401914-96401936 CAGAATAGAAAAGTGGAGGATGG + Intergenic
1031995269 7:128226491-128226513 AAGGATGGACAATAGGAGGATGG - Intergenic
1031995274 7:128226514-128226536 AAGGATGGACAATAGGAGGATGG - Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1033479730 7:141727855-141727877 CCTGGTACACATTTGGAGGAAGG + Intronic
1033653413 7:143358784-143358806 CAAGAGACACATTTGCAGGATGG - Intronic
1034158122 7:148972278-148972300 CCGGATACAGAATAGGAGGCTGG - Intergenic
1035573790 8:691119-691141 TAGGAAACACAATTAGAGGGTGG + Intronic
1035988108 8:4456909-4456931 CAGGATAAACAGTTGGTGGGTGG - Intronic
1037387096 8:18354773-18354795 CTGGATACACAATTGTAGATTGG + Intergenic
1038124604 8:24658762-24658784 CAAGATACAGGATTGAAGGAAGG - Intergenic
1042401425 8:68352619-68352641 CAGAATAAAAAATTGTAGGAAGG - Intronic
1043740686 8:83807884-83807906 CAGCCTACACACTGGGAGGATGG - Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047886707 8:129259166-129259188 CAATATACACAATGGGAGGAGGG + Intergenic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1050775692 9:9257356-9257378 TATGAGACACAATTTGAGGATGG + Intronic
1053165189 9:35839517-35839539 CACGTTACACAGTTGAAGGAAGG + Intronic
1053441501 9:38120204-38120226 TAGGACACAGAATTGGAGAAAGG + Intergenic
1054362764 9:64193156-64193178 CAGGATAAACACTAGAAGGAAGG + Intergenic
1054363720 9:64207679-64207701 CAGGATAAAAAATAGAAGGAAGG - Intergenic
1055448895 9:76412528-76412550 CAGGATACACAATTCTAGTTGGG + Intergenic
1058880677 9:109283453-109283475 CAGGATATGCAACTGGAGAAAGG + Intronic
1060803980 9:126563523-126563545 CAGGATGCAGAAGTGGAGGACGG + Intergenic
1188635601 X:32426952-32426974 GAGGATAGAGAATGGGAGGAAGG + Intronic
1192147522 X:68691738-68691760 CAGGAAACAAAAAAGGAGGAGGG - Intronic
1192866432 X:75137871-75137893 GAGGGTAGACAATGGGAGGAGGG + Intronic
1194014726 X:88605112-88605134 CAGCCTGCACACTTGGAGGAAGG + Intergenic
1196948027 X:120848222-120848244 AAGGATACAGAATTGCAGAATGG - Intergenic
1197161578 X:123329109-123329131 CTGAATACACTCTTGGAGGATGG - Intronic
1197295515 X:124714210-124714232 CAGGTTACACAATTGGTAAAAGG + Intronic
1197679524 X:129367327-129367349 CAGGGTAGACCATCGGAGGAAGG + Intergenic