ID: 1004950722

View in Genome Browser
Species Human (GRCh38)
Location 6:20668136-20668158
Sequence TTCCATATGGATATATACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 320}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004950719_1004950722 -1 Left 1004950719 6:20668114-20668136 CCAATTGTGTATCCTGGAATAAT 0: 1
1: 0
2: 2
3: 12
4: 174
Right 1004950722 6:20668136-20668158 TTCCATATGGATATATACAAAGG 0: 1
1: 0
2: 0
3: 29
4: 320
1004950713_1004950722 14 Left 1004950713 6:20668099-20668121 CCTCCCTTCCTTCCTCCAATTGT 0: 1
1: 0
2: 9
3: 153
4: 1828
Right 1004950722 6:20668136-20668158 TTCCATATGGATATATACAAAGG 0: 1
1: 0
2: 0
3: 29
4: 320
1004950709_1004950722 23 Left 1004950709 6:20668090-20668112 CCCTCCCTGCCTCCCTTCCTTCC 0: 17
1: 2161
2: 8050
3: 20205
4: 30192
Right 1004950722 6:20668136-20668158 TTCCATATGGATATATACAAAGG 0: 1
1: 0
2: 0
3: 29
4: 320
1004950715_1004950722 10 Left 1004950715 6:20668103-20668125 CCTTCCTTCCTCCAATTGTGTAT 0: 1
1: 0
2: 3
3: 28
4: 283
Right 1004950722 6:20668136-20668158 TTCCATATGGATATATACAAAGG 0: 1
1: 0
2: 0
3: 29
4: 320
1004950718_1004950722 2 Left 1004950718 6:20668111-20668133 CCTCCAATTGTGTATCCTGGAAT 0: 1
1: 0
2: 0
3: 9
4: 160
Right 1004950722 6:20668136-20668158 TTCCATATGGATATATACAAAGG 0: 1
1: 0
2: 0
3: 29
4: 320
1004950714_1004950722 11 Left 1004950714 6:20668102-20668124 CCCTTCCTTCCTCCAATTGTGTA 0: 1
1: 0
2: 6
3: 28
4: 346
Right 1004950722 6:20668136-20668158 TTCCATATGGATATATACAAAGG 0: 1
1: 0
2: 0
3: 29
4: 320
1004950712_1004950722 18 Left 1004950712 6:20668095-20668117 CCTGCCTCCCTTCCTTCCTCCAA 0: 1
1: 1
2: 31
3: 996
4: 10878
Right 1004950722 6:20668136-20668158 TTCCATATGGATATATACAAAGG 0: 1
1: 0
2: 0
3: 29
4: 320
1004950711_1004950722 19 Left 1004950711 6:20668094-20668116 CCCTGCCTCCCTTCCTTCCTCCA 0: 1
1: 8
2: 431
3: 5295
4: 22921
Right 1004950722 6:20668136-20668158 TTCCATATGGATATATACAAAGG 0: 1
1: 0
2: 0
3: 29
4: 320
1004950716_1004950722 6 Left 1004950716 6:20668107-20668129 CCTTCCTCCAATTGTGTATCCTG 0: 1
1: 0
2: 1
3: 14
4: 197
Right 1004950722 6:20668136-20668158 TTCCATATGGATATATACAAAGG 0: 1
1: 0
2: 0
3: 29
4: 320
1004950710_1004950722 22 Left 1004950710 6:20668091-20668113 CCTCCCTGCCTCCCTTCCTTCCT 0: 16
1: 2124
2: 9237
3: 55697
4: 53364
Right 1004950722 6:20668136-20668158 TTCCATATGGATATATACAAAGG 0: 1
1: 0
2: 0
3: 29
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004950722 Original CRISPR TTCCATATGGATATATACAA AGG Intronic
902439393 1:16419617-16419639 TTCCATGTTCATATATCCAATGG - Intronic
903903052 1:26662645-26662667 TTCCATATATTTATATAGAAAGG + Intergenic
903937586 1:26907171-26907193 TTCCAAACAGATATATGCAAAGG - Intronic
909432580 1:75606722-75606744 TTTCATATTAATAAATACAATGG + Intronic
909457240 1:75863678-75863700 TTCCATATTGCTATATCCAGTGG + Intronic
909499349 1:76316551-76316573 TTGCTTAGGGACATATACAACGG + Intronic
910472244 1:87567133-87567155 TTCCATATGGACAGAGACACTGG - Intergenic
910537637 1:88317381-88317403 TTCCAGATGTATAAATCCAAGGG - Intergenic
911856093 1:102877427-102877449 TTCAACATCAATATATACAAAGG + Exonic
912034625 1:105296580-105296602 ATCCATTTGGAAATATATAAAGG - Intergenic
912197948 1:107422312-107422334 TGCCATATGGAAAGAAACAAAGG + Intronic
912220021 1:107663218-107663240 TTCCATTTGAATATCTGCAAAGG - Intronic
914897319 1:151688307-151688329 TTACATAAGGATATTTAAAAGGG - Intronic
916149922 1:161777095-161777117 TTCCATATTGCTAAATTCAATGG - Intronic
918217296 1:182403153-182403175 TTTAATTTGGATATATACCAAGG + Intergenic
918922943 1:190738489-190738511 TTCCACATAGATATAGCCAAAGG + Intergenic
918938892 1:190963634-190963656 ATACATATGGACATTTACAAAGG + Intergenic
919083831 1:192896824-192896846 ATACATATGTATATACACAATGG + Intergenic
919220264 1:194619213-194619235 TTCCATATATGTATATATAATGG + Intergenic
921319802 1:213927717-213927739 TTCCATATGGCAATTTAGAAGGG - Intergenic
921644038 1:217591215-217591237 ATACATATGCATATATATAATGG + Intronic
921987258 1:221325815-221325837 GTACATATGGATATAAAGAAAGG - Intergenic
923851603 1:237802360-237802382 TTCTATTTGGATATATATTACGG - Intronic
924100523 1:240598508-240598530 CACCATATGGATTTGTACAAAGG - Intronic
924252024 1:242142440-242142462 TCCCATTTGGAAATATACAAAGG - Intronic
1065234401 10:23633875-23633897 CTCTATATGTATATATCCAAAGG - Intergenic
1065363496 10:24911908-24911930 TTTCATTTGGATAAATACATAGG + Intronic
1065570452 10:27066376-27066398 TTCCTTATGGATGTATGCAGAGG + Intronic
1065825763 10:29569478-29569500 TTCCACATGGAAATTTACATAGG + Intronic
1065951587 10:30657142-30657164 TTCCACATGGAAATTTACATAGG - Intergenic
1066963098 10:42238591-42238613 TTCCTTAGGGATATACCCAAGGG + Intergenic
1066999702 10:42597840-42597862 TTACATATAAATTTATACAATGG + Intronic
1068110947 10:52680430-52680452 TTCCATATGGATACTGTCAAAGG + Intergenic
1069106481 10:64389046-64389068 ATACATATGGAAATATATAAAGG + Intergenic
1071008626 10:80912190-80912212 TTCCATATAGATAGATCCACAGG + Intergenic
1071085570 10:81865092-81865114 TTCTATATGGAAATTTACAAGGG - Intergenic
1073357186 10:102866301-102866323 TTCCTTATGCATAGAAACAAGGG + Intronic
1074488833 10:113919605-113919627 TACCTTATGGAAATATATAAAGG + Intergenic
1074560139 10:114528356-114528378 TTCCACATGTCTATATAAAAGGG - Intronic
1079780341 11:24594669-24594691 TTCCATATGAATATTTACTTAGG - Intronic
1080090557 11:28343158-28343180 TTATATATGTATGTATACAATGG - Intergenic
1081370039 11:42289477-42289499 TTAAATATGTATATATACATGGG - Intergenic
1081381826 11:42425820-42425842 TTTCTTGTGGAGATATACAATGG - Intergenic
1082199055 11:49340892-49340914 ATCCATCTAGATATATACACAGG - Intergenic
1082700583 11:56424888-56424910 CTCACTATGGATATATACAATGG + Intergenic
1083121605 11:60518750-60518772 TTCCATATTGCTAAATCCAATGG - Intronic
1083283029 11:61639142-61639164 TTCTATATGGATGTATACAGGGG - Intergenic
1085631895 11:78125396-78125418 TTTTATATGTATATATAAAATGG - Intronic
1086227623 11:84531277-84531299 GTACATATGGATACAAACAAGGG + Intronic
1086622185 11:88900419-88900441 TTACATATAGATATATAAAGTGG + Intronic
1086656762 11:89367228-89367250 ATCCATCTAGATATATACACAGG + Intronic
1086769851 11:90748277-90748299 CTCCAGATGGATATAGCCAAGGG - Intergenic
1087310677 11:96538536-96538558 TTTCAGATGGGTATATCCAATGG - Intergenic
1090882163 11:130843173-130843195 TTAGATATAGATATATACAAGGG + Intergenic
1091083643 11:132697625-132697647 TTCTATATAAAAATATACAATGG - Intronic
1092374823 12:7946744-7946766 TTCCAGATGGAAGAATACAAAGG - Intergenic
1092756087 12:11764757-11764779 TTCCACATGGAGAACTACAAAGG - Intronic
1092942618 12:13424471-13424493 TTCCACATGGAAATGTACAGAGG + Intergenic
1094330039 12:29281297-29281319 TTCCTTATGGTTATATTCTAGGG - Intronic
1095266662 12:40167325-40167347 TTCCACATGGAGATAAACACTGG + Intergenic
1095664650 12:44782952-44782974 TTCCCAAGGGATATATACCAAGG + Intronic
1095712749 12:45307883-45307905 TTCCCTATTGTTAAATACAATGG - Intronic
1098034450 12:66287927-66287949 TTCCACATGGCTAAATGCAATGG - Intergenic
1099320499 12:81141779-81141801 TTCCATTTCTATTTATACAATGG - Intronic
1099381443 12:81957752-81957774 TTTCATTTGCATATATACATTGG + Intergenic
1104737420 12:131144924-131144946 TCCCATTTGGATAAATACTAAGG + Intergenic
1105537653 13:21284017-21284039 TTCAATGTTGGTATATACAAGGG - Intergenic
1106283499 13:28298317-28298339 CTCCATATTGATAAATCCAATGG - Intergenic
1108851712 13:54737987-54738009 TTCCTCATGGTTTTATACAAAGG - Intergenic
1109006108 13:56879949-56879971 TTCCATATGATTATATACTCTGG - Intergenic
1109121636 13:58465143-58465165 GTTCATATGGATATATTAAATGG - Intergenic
1112123252 13:96436336-96436358 TAAAATATGGATTTATACAAAGG - Intronic
1112973771 13:105291840-105291862 TTGCATATGAGTATATATAAAGG - Intergenic
1113266002 13:108618650-108618672 TTGCATATGGATACAAATAAGGG - Intronic
1113279275 13:108771175-108771197 GTCTATATAGATATATACACGGG + Intronic
1113319324 13:109216756-109216778 TACTATATATATATATACAAAGG + Intergenic
1113325628 13:109278466-109278488 TTCCATGCAGATATAGACAATGG - Intergenic
1115847074 14:37550143-37550165 TTGAATAAGGAAATATACAAAGG - Exonic
1116676352 14:47910799-47910821 TTCCATATTGGTAAATCCAATGG + Intergenic
1117023458 14:51595731-51595753 TTCCATATGGCTATAGACTATGG + Intronic
1117210138 14:53488848-53488870 GTATATATAGATATATACAATGG + Intergenic
1117846027 14:59912791-59912813 TTCCAGATGGATATATATTTTGG + Intergenic
1118162785 14:63307652-63307674 ATACATATATATATATACAATGG + Intergenic
1118216598 14:63814516-63814538 TTATATATGGATATATATAATGG - Intergenic
1120942250 14:89959720-89959742 TTCCATATGGTTTTAGAAAATGG + Intronic
1121679563 14:95781629-95781651 TTATATATGTATATATATAAAGG - Intergenic
1122136789 14:99638088-99638110 TTCCATAAGGATGTTTACGAAGG + Intergenic
1123441967 15:20298836-20298858 TTCCTTAGGGATATACCCAAGGG - Intergenic
1125120191 15:36147489-36147511 TTCAATAAGGATAAATACATGGG + Intergenic
1126201235 15:45988982-45989004 TTCCATATTCATGGATACAAAGG - Intergenic
1126232878 15:46347649-46347671 TTCCATATGCAAATATTCAGTGG - Intergenic
1130733364 15:86522510-86522532 TTCCCCATGGATGTATATAATGG + Intronic
1131645858 15:94343017-94343039 CTCCATATGTATATATATATAGG - Intronic
1131719266 15:95149462-95149484 ATATATATGGACATATACAAAGG + Intergenic
1133486106 16:6220086-6220108 TTCTATATGTACATATATAAGGG + Intronic
1135201441 16:20440804-20440826 TGCCAAATGGTTACATACAAAGG - Exonic
1135776776 16:25263524-25263546 TTGCATATGTATATATTTAATGG + Intergenic
1136719244 16:32306680-32306702 TTCCTTAGGGATATACCCAAGGG + Intergenic
1136724269 16:32345046-32345068 TTCCTTAGGGATATACCCAAGGG + Intergenic
1136837614 16:33512944-33512966 TTCCTTAGGGATATACCCAAGGG + Intergenic
1136842596 16:33551088-33551110 TTCCTTAGGGATATACCCAAGGG + Intergenic
1138538557 16:57673854-57673876 TTCCAGCTGGATCTAAACAATGG + Intronic
1140380828 16:74485759-74485781 TACAATATGGATAAATACCATGG + Intronic
1141010547 16:80393481-80393503 TTCCAAATGGATATATCCTAAGG + Intergenic
1203002163 16_KI270728v1_random:172719-172741 TTCCTTAGGGATATACCCAAGGG - Intergenic
1203007187 16_KI270728v1_random:211091-211113 TTCCTTAGGGATATACCCAAGGG - Intergenic
1203133766 16_KI270728v1_random:1709126-1709148 TTCCTTAGGGATATACCCAAGGG - Intergenic
1203152761 16_KI270728v1_random:1851385-1851407 TTCCTTAGGGATATACCCAAGGG + Intergenic
1149154139 17:53606220-53606242 TACCATTTGGATTTATAGAAAGG - Intergenic
1149257769 17:54846428-54846450 TTATATATGTGTATATACAATGG - Intergenic
1149499796 17:57143784-57143806 ATCCATATGGCTATATAAATAGG - Intergenic
1155557405 18:27035074-27035096 TTCCATATGGTTTTCTACAATGG + Intronic
1155665399 18:28301898-28301920 ATTCATTTGGATAAATACAAAGG - Intergenic
1155678051 18:28454026-28454048 TTACATATACATATATACAGAGG - Intergenic
1155810247 18:30224245-30224267 TTCCATTTGGAAAGTTACAAAGG + Intergenic
1155841016 18:30642683-30642705 TTACATATGGATATATTTATAGG + Intergenic
1155965274 18:32029828-32029850 ATCCAAATGGAAATATCCAAAGG + Intronic
1156166009 18:34421805-34421827 TTCCAAATGGATCTATAAAGAGG - Intergenic
1157073567 18:44439090-44439112 GTACACATGGATATAAACAAGGG - Intergenic
1158747775 18:60221094-60221116 TTTCATATATATATACACAATGG - Intergenic
1159632970 18:70770464-70770486 TTCCATATTGATATTTAGAGGGG - Intergenic
1160110922 18:76029288-76029310 TCCCATAATGATATAAACAAAGG - Intergenic
1162875119 19:13615802-13615824 TTAGATATGGGCATATACAAGGG + Intronic
1164057268 19:21632245-21632267 GTCCAAAAGGAGATATACAAAGG + Intergenic
1164756488 19:30693801-30693823 ATCTATATGGATATATACTGTGG + Intronic
1165165793 19:33854884-33854906 TTCCATATGTATATATAAACAGG + Intergenic
1166273192 19:41731309-41731331 TTGCACATAGATAAATACAATGG + Intronic
1166429696 19:42714251-42714273 TTGCACATGGATAAATACATTGG - Intronic
1166443329 19:42835569-42835591 TTGCACATGGATAAATACATTGG - Intronic
1166463017 19:43006224-43006246 TTGCATATGGATAAATACATTGG - Intronic
1166469157 19:43062779-43062801 TTGCACATGGATAAATACATCGG - Intronic
1166490120 19:43251855-43251877 TTGCACATGGATAAATACATCGG - Intronic
926038426 2:9653503-9653525 ATGCATATGGAAATAGACAAAGG - Intergenic
928806941 2:35170114-35170136 TTCCATATAATTATATATAAAGG + Intergenic
930367991 2:50466701-50466723 GTACATATGTATATATATAATGG + Intronic
930991621 2:57663254-57663276 TTCCATATGGGTATACACCTTGG + Intergenic
931591193 2:63885189-63885211 TTACAAATGGATATATTCAGGGG - Intronic
932537113 2:72610618-72610640 GTCCATACTGATATAAACAAAGG + Intronic
934321875 2:91978516-91978538 TTCCTTAGGGATATACCCAAGGG - Intergenic
935482158 2:103603965-103603987 TTGCATTTGGACATATCCAAAGG + Intergenic
935851098 2:107219868-107219890 TTGCATATGGATGAATACACTGG + Intergenic
937484483 2:122300331-122300353 TTACATATGGAAATATACACAGG - Intergenic
937582144 2:123499960-123499982 ATATATATGGATATATATAAAGG + Intergenic
937823795 2:126342399-126342421 TTCAATATGCACATATAAAATGG + Intergenic
939906348 2:147920883-147920905 GTGCATATGGATATATACAGAGG - Intronic
939909192 2:147960179-147960201 CTCCTTATGCATATATAAAATGG - Intronic
940280810 2:151987829-151987851 TTGGAAATGGAAATATACAAAGG - Intronic
940298340 2:152152820-152152842 TTCTTTAGGGATATATACACAGG + Intronic
940555413 2:155220780-155220802 TTCCATTTGGGTATATACCTAGG - Intergenic
941046335 2:160679739-160679761 TTCCATGTGGTTATGGACAATGG - Intergenic
941259002 2:163272986-163273008 TCCCATATGGATGGATAGAATGG - Intergenic
942526557 2:176859478-176859500 TTTCATGTGGGTAAATACAAAGG - Intergenic
943076114 2:183197236-183197258 TTCCATATTGCTAAATAAAATGG + Intergenic
945309189 2:208290613-208290635 ATTCATATGGATAAATACCAAGG + Intronic
945310798 2:208310232-208310254 TCCCATTTGTATTTATACAAAGG - Intronic
945712668 2:213318453-213318475 GTACATATGGACATATAGAATGG + Intronic
947040140 2:225909196-225909218 TTCTATATGCATATTTACAAAGG - Intergenic
948148477 2:235726526-235726548 TTCCATTGGGATAGATTCAATGG - Intronic
1169596478 20:7205471-7205493 TTCCTAAAGGATATTTACAATGG - Intergenic
1170111905 20:12813895-12813917 TTCCATTTTGATTTATATAATGG - Intergenic
1170766612 20:19294585-19294607 ATCCATATATATATATGCAAAGG + Intronic
1174329651 20:49808049-49808071 TTTCATATTGATTTATACATGGG - Intergenic
1177452823 21:21293668-21293690 TTACATATTGATATAGATAAAGG - Intronic
1177865729 21:26511114-26511136 TCACATATGGATACACACAAAGG - Intronic
1178214468 21:30578471-30578493 TTCTATATAGTTATATAGAACGG + Intergenic
1179045368 21:37839628-37839650 TTTCATATGGAAAGTTACAATGG - Intronic
1180548616 22:16524434-16524456 TTCCTTAGGGATATACCCAAGGG - Intergenic
1181936805 22:26444648-26444670 TTCCATTTGGATCTAAACACTGG - Exonic
949366169 3:3283429-3283451 TTGCACATGGAAATATACAATGG + Intergenic
949726432 3:7051808-7051830 TTCCACATGGATACAGAAAATGG + Intronic
950586101 3:13893595-13893617 TTCCATATGAATTTAACCAAAGG - Intergenic
951689565 3:25381637-25381659 TTCCATATGCACACATGCAAGGG - Intronic
951811736 3:26708091-26708113 TCCCAGATGGATAAATACAAAGG - Intronic
956529759 3:70204833-70204855 TTCACTGTGGATATGTACAATGG + Intergenic
956628295 3:71288932-71288954 TTCCATATTGACAAATCCAATGG + Intronic
957774176 3:84734400-84734422 TTTTATATTTATATATACAATGG + Intergenic
958212481 3:90505095-90505117 TTCCAAGTGGATATTTACAGCGG - Intergenic
958213814 3:90532559-90532581 TTCCAAATGGATATTTAGAGCGG - Intergenic
958218328 3:90624043-90624065 TTCCAAGTGGATATTTACAGCGG - Intergenic
958219522 3:90647246-90647268 TTCCAAGTGGATATTTAGAACGG - Intergenic
958219625 3:90649286-90649308 TTCCAAGTGGATATTTACAGCGG - Intergenic
958220027 3:90657781-90657803 TTCCAAGTGGATATTTACAGCGG - Intergenic
958220139 3:90659992-90660014 TTCCAAGTGGATATTTAGAACGG - Intergenic
958221375 3:90686969-90686991 TTCCAAATGGATATTTAGAGCGG - Intergenic
958222384 3:90708044-90708066 TTCCAAGTGAATATTTACAACGG - Intergenic
958224930 3:90802798-90802820 TTCCAAATGGATTTTTACAGCGG + Intergenic
958226837 3:90835081-90835103 TTCCAAGTGGATATTTACAGCGG + Intergenic
958227453 3:90845278-90845300 TTCCAAGTGGATTTTTACAACGG + Intergenic
958238998 3:91039814-91039836 TTCCAAGTGGATTTTTACAACGG + Intergenic
958240719 3:91068693-91068715 TTCCATGTGGATTTTTACAGCGG + Intergenic
958251999 3:91277855-91277877 TTCCATGTGGATTTTTACAGCGG - Intergenic
958660080 3:97055512-97055534 ATTCATATGGAAATACACAAGGG + Intronic
960135645 3:114102044-114102066 TTCCATCTGGAAGTACACAATGG + Intergenic
960354876 3:116638905-116638927 TAACATATGGATATATATATGGG + Intronic
962168379 3:133075222-133075244 TTCCTCTGGGATATATACAAGGG + Intronic
962747437 3:138407476-138407498 TTCCATTTGGCTAAATTCAAAGG + Intergenic
962944964 3:140159659-140159681 TTTCATTTGGATATATACCCAGG - Intronic
963432757 3:145230577-145230599 TTACATATATATATATAAAAAGG - Intergenic
964961519 3:162433626-162433648 TTTCTTTTGGATATATACCAAGG - Intergenic
965091286 3:164165423-164165445 TGAAATATGGATGTATACAAAGG + Intergenic
965197133 3:165615114-165615136 TTCCCTAAGGAAATATAAAAAGG + Intergenic
965465509 3:169025220-169025242 TTATATGTGCATATATACAATGG + Intergenic
965496742 3:169407727-169407749 TTCCATATGGATAGATAGACAGG - Intronic
965890205 3:173503858-173503880 TTCCATATGCATAACTAGAAGGG + Intronic
966018878 3:175181896-175181918 TTTCATTTGGATATATACCTAGG + Intronic
968182469 3:196606492-196606514 TTCCATATGTACATATACATGGG + Intergenic
968732858 4:2279017-2279039 TTCCTTATGGAAAAATAAAATGG + Intronic
969133910 4:5014359-5014381 TTTCCTTTGGATATATACATTGG - Intergenic
970045616 4:11850200-11850222 TTGCTTATGTATATATTCAAAGG + Intergenic
970099737 4:12506823-12506845 TGTCACATGGATATAAACAAAGG - Intergenic
970795736 4:19910910-19910932 TTCCATATGGATGTATAAACAGG + Intergenic
971740976 4:30520751-30520773 ATAAATATGGAAATATACAAAGG - Intergenic
971843429 4:31886393-31886415 TTCCATATATATATATAGCAGGG - Intergenic
972525673 4:39908209-39908231 ATCCTTATGAATAAATACAATGG - Intronic
974544680 4:63285529-63285551 TTCAATTTGGATTTAAACAATGG + Intergenic
974623762 4:64395863-64395885 TTACATATGGACACATAAAAGGG - Intronic
975162568 4:71140458-71140480 TTCCAAATGTATATCTTCAACGG + Intergenic
976324433 4:83754896-83754918 TTCCTTGAGGATATATAGAAGGG + Intergenic
978425242 4:108575380-108575402 TTTCATATATATATATATAAAGG - Intergenic
978503921 4:109436375-109436397 TTCCATAGAGATATATTAAAAGG - Intronic
979288543 4:118954735-118954757 GTCTATATAGCTATATACAAGGG + Intronic
979368378 4:119852479-119852501 TTCTATATGGTGATATATAAGGG - Intergenic
981682502 4:147415723-147415745 TTCCATATTGATGTAAATAATGG + Intergenic
981989883 4:150905418-150905440 ATATATATGGATATTTACAATGG + Intronic
982976053 4:162062570-162062592 TTCTATATGGATATAAAGTAAGG - Intronic
983215109 4:164995501-164995523 TCCCATTTGGAGATAAACAAAGG + Intergenic
983336176 4:166396221-166396243 TACTATGTGGATAAATACAAAGG - Intergenic
984035648 4:174664226-174664248 ATCCATAGGGATAGATACGATGG - Intronic
984288666 4:177765237-177765259 TTCTATATGGAATTATAGAATGG + Intronic
987251197 5:16102973-16102995 TTCCATATGTATTTTTACATCGG - Intronic
987622759 5:20356697-20356719 CTAGATATGGATATATACCAAGG + Intronic
989698945 5:44238793-44238815 ATCAAAATGGATATTTACAAGGG + Intergenic
990622977 5:57580105-57580127 TTTCCTATGGATATATACCCAGG + Intergenic
991210304 5:64096873-64096895 TTCCATATGGATAGACATATGGG - Intergenic
992062317 5:73065930-73065952 TTACACATGGACATATACAGTGG - Intronic
993200510 5:84810342-84810364 TTCCATATGGATATTTCACATGG + Intergenic
994610249 5:102027619-102027641 TTACATATTGCTATATATAAAGG - Intergenic
995589995 5:113689431-113689453 ATCCATATAGATAGACACAAAGG - Intergenic
996429129 5:123351502-123351524 TTCCTACTGGATATATACATAGG + Intronic
998360411 5:141581142-141581164 TTGGATATGGATACATACAGAGG + Intronic
998702493 5:144718964-144718986 TCCCATATGGATATGTACTAGGG - Intergenic
999391891 5:151199295-151199317 TTCCATGTGGATAATTACATGGG - Intronic
1000710768 5:164574239-164574261 ATATATATGTATATATACAATGG - Intergenic
1000940134 5:167350783-167350805 ATACATATGGATATATATATGGG + Intronic
1000940137 5:167350810-167350832 ATACATATGGATATATATATGGG + Intronic
1000940140 5:167350837-167350859 ATACATATGGATATATATATGGG + Intronic
1000940146 5:167350893-167350915 ATACATATGGATATATATATGGG + Intronic
1000940149 5:167350920-167350942 ATACATATGGATATATATATGGG + Intronic
1000940152 5:167350947-167350969 ATACATATGGATATATATATGGG + Intronic
1000940164 5:167351059-167351081 ATACATATGGATATATATATGGG + Intronic
1000940170 5:167351115-167351137 ATACATATGGATATATATATGGG + Intronic
1001914800 5:175550724-175550746 TTACATATGGATAAATAAATTGG + Intergenic
1003720928 6:8701298-8701320 TTCCAAATGGATATAAACTCTGG + Intergenic
1004950722 6:20668136-20668158 TTCCATATGGATATATACAAAGG + Intronic
1005015843 6:21374838-21374860 CTCCTTATGGATATATAACATGG - Intergenic
1010140534 6:72609565-72609587 TTCCATATAAATTTATACAAGGG - Intergenic
1010354489 6:74915842-74915864 TTCCATAAGGACAGAGACAATGG + Intergenic
1010431918 6:75787641-75787663 TTCCATATATATATATATATGGG + Intronic
1012640407 6:101604312-101604334 ATGTATATGGATATATCCAATGG + Intronic
1012776584 6:103502119-103502141 TTTCAAAAGGAGATATACAAAGG - Intergenic
1013050279 6:106527204-106527226 TTCTATATATATATATAAAATGG + Intronic
1013260920 6:108441437-108441459 TTGCATATTTATATATACAAAGG - Intronic
1014826379 6:126052557-126052579 ATGCATAAGGATATATAAAAAGG - Intergenic
1014884143 6:126759076-126759098 TACCATATGACTACATACAAAGG + Intergenic
1015814950 6:137199271-137199293 TTTCATATATATATATATAAAGG - Intronic
1015825625 6:137308336-137308358 ATCAATATTGATATATAAAAAGG + Intergenic
1016506024 6:144780133-144780155 TTACAAATGGATAAATACAAAGG + Intronic
1017241786 6:152178457-152178479 ATCCATTTGGATTTATCCAATGG + Intronic
1018251140 6:161871841-161871863 TCCCATATGCAAATATACACGGG - Intronic
1019125198 6:169834228-169834250 ATCCAAATGGAGATATAAAAGGG + Intergenic
1020916211 7:14196813-14196835 TTCAACATGTCTATATACAAGGG - Intronic
1021107179 7:16651402-16651424 TTCTGTGTGGATATATAAAAAGG - Intronic
1023088463 7:36595808-36595830 TTCAATATTGAGAAATACAAAGG - Intronic
1025213465 7:57035124-57035146 TTTCCTATGGATTTTTACAATGG + Intergenic
1025258764 7:57403518-57403540 TTCCAAAGGGATATTTAAAAAGG + Intergenic
1025658488 7:63541699-63541721 TTTCCTATGGATTTTTACAATGG - Intergenic
1025709880 7:63899527-63899549 TTCCAAAGGGATATTTAAAAAGG + Intergenic
1026551664 7:71374025-71374047 TTCCATAGAAATATTTACAAAGG + Intronic
1029010379 7:97254609-97254631 TGTGATATAGATATATACAATGG + Intergenic
1029583137 7:101450835-101450857 TTCCATATTCATATAGACTATGG - Intronic
1030536828 7:110777742-110777764 TTCCATATTGACAGTTACAAGGG + Intronic
1030752967 7:113254172-113254194 TTTCTTATGGATATATACCTAGG - Intergenic
1031103399 7:117510144-117510166 TTCCATAAGAATATATATTATGG - Intronic
1033148775 7:138894733-138894755 CGACATATGGATATATCCAAAGG + Intronic
1033500450 7:141943803-141943825 TTCCATAAGAATAAAGACAATGG + Intronic
1033789265 7:144771699-144771721 ATCCATATGGATTAATACACAGG + Intronic
1035964254 8:4172810-4172832 TTCCATATGGACATATCCAGGGG - Intronic
1036002970 8:4629682-4629704 TTCCATATTAATATTTACATTGG + Intronic
1037000169 8:13707763-13707785 TTCAATGTGGGTATCTACAAAGG + Intergenic
1037035017 8:14155710-14155732 TTATATATTTATATATACAAAGG + Intronic
1037267504 8:17081491-17081513 TTTTATATGGATATCTACAAAGG + Intronic
1037880053 8:22568908-22568930 TTCCATAGGGATATATGGAGTGG - Intronic
1038864076 8:31420269-31420291 GAATATATGGATATATACAAAGG - Intergenic
1040657881 8:49533126-49533148 TTCCATATAGATGCATAAAAGGG + Intergenic
1042845179 8:73162728-73162750 TTCCATTTGGATAGAAAAAATGG - Intergenic
1043984183 8:86674475-86674497 TTCCATATGTATATAGGCAGAGG - Intronic
1045283423 8:100769852-100769874 TTACATATATATATATATAATGG + Intergenic
1045337433 8:101220702-101220724 TTTCCTTTGGATATATACATTGG - Intergenic
1045791697 8:105991383-105991405 TTCCTTATGGCTATGTACAATGG + Intergenic
1046425342 8:114040958-114040980 TTCCATATGGTTTTATATAATGG - Intergenic
1047126543 8:121968371-121968393 GTTCATTTGGATAAATACAAAGG - Intergenic
1047419539 8:124695558-124695580 CTCCAAAAGGATATATACATGGG + Intronic
1047986693 8:130242659-130242681 TAGCATATGGAGATTTACAATGG - Intronic
1049941448 9:549955-549977 TTCCCTAGGGTAATATACAAAGG + Intronic
1050171378 9:2821798-2821820 TTACATATGAATATATTCACTGG + Intronic
1050190655 9:3022093-3022115 TTCCAAATGTATATATAGACAGG + Intergenic
1050412129 9:5377465-5377487 TTTTATATAGATAAATACAAAGG - Intronic
1050718415 9:8556633-8556655 GTCCACTTGCATATATACAAGGG + Intronic
1050898778 9:10917751-10917773 TTTCATAAGAATATATTCAAAGG + Intergenic
1051114382 9:13677295-13677317 ATCAATCTGGATATACACAATGG + Intergenic
1051131854 9:13870996-13871018 TTTCAGATGAATGTATACAACGG - Intergenic
1052691039 9:31817308-31817330 TACCTGATGGATACATACAAAGG + Intergenic
1053061780 9:35037483-35037505 GACCATATGGATTTAGACAATGG - Intergenic
1053570676 9:39302207-39302229 TTCCATGTGGAAATCTAAAAGGG - Intergenic
1053836624 9:42143124-42143146 TTCCATGTGGAAATCTAAAAGGG - Intergenic
1054092298 9:60861224-60861246 TTCCATGTGGAAATCTAAAAGGG - Intergenic
1054113711 9:61136817-61136839 TTCCATGTGGAAATCTAAAAGGG - Intergenic
1054126469 9:61316805-61316827 TTCCATGTGGAAATCTAAAAGGG + Intergenic
1054593984 9:67045370-67045392 TTCCATGTGGAAATCTAAAAGGG + Intergenic
1055193645 9:73559564-73559586 TTCCATATGGCTCTATCCATAGG + Intergenic
1056344906 9:85682681-85682703 TTCCACATGGAGATAGTCAAGGG + Intronic
1057976909 9:99614969-99614991 TTCAATCTGTATATATACAATGG + Intergenic
1058577920 9:106423142-106423164 TTACATCTGCATAAATACAATGG - Intergenic
1060227749 9:121805599-121805621 ATACATATACATATATACAATGG + Intergenic
1060573746 9:124669281-124669303 TTAAATATGGATATATACTTTGG + Intronic
1186948405 X:14595156-14595178 TTCCCTATTGATATCTCCAAGGG - Intronic
1187373461 X:18729417-18729439 TTTCATAAGAACATATACAAAGG - Intronic
1187744001 X:22388334-22388356 TTTTAAATGGATATATAAAAGGG + Intergenic
1187752283 X:22479535-22479557 TTTCATTTGGATAAATACTAGGG - Intergenic
1187995708 X:24924432-24924454 TTCCATGGGGATATACACATAGG + Intronic
1188258354 X:27990437-27990459 TTAAATATGGATATATGCTAGGG - Intergenic
1188589299 X:31814537-31814559 TTCTATATGTCCATATACAATGG + Intronic
1189149682 X:38692781-38692803 TACCATTTGAATATATTCAAAGG - Intergenic
1189444547 X:41068284-41068306 TTCCACATGGACATAAAAAAGGG - Intergenic
1190105371 X:47556845-47556867 TTCCAGATGGATAATTACAAGGG + Intergenic
1190996329 X:55613628-55613650 ATATATATGGATATATATAAAGG + Intergenic
1191969285 X:66795644-66795666 ATCCATATGTATATTTACTATGG - Intergenic
1193863000 X:86694323-86694345 TTCCATATGGTTTTAAGCAATGG + Intronic
1194276193 X:91885696-91885718 TTTCATCTTCATATATACAAAGG - Intronic
1195124858 X:101798224-101798246 GTACATATGGATATAAAGAAAGG + Intergenic
1195537625 X:106026748-106026770 TTCCTTATGGGTATAAACCACGG - Intergenic
1195728221 X:107939001-107939023 TTCCATATGAATATGTATTACGG - Intergenic
1195868139 X:109455811-109455833 TTCCAGATTGATATAGTCAATGG + Intronic
1196291056 X:113941666-113941688 TTTTGTATGTATATATACAATGG + Intergenic
1197283609 X:124567502-124567524 TTCCATGTTGATAAATCCAATGG - Intronic
1197920313 X:131585797-131585819 TTCCATATGGGTATCTGCCAGGG - Intergenic
1198954383 X:142111745-142111767 TGCCAAATAGATATATTCAAAGG - Intergenic
1199641961 X:149871050-149871072 ATACATTGGGATATATACAAAGG - Intergenic
1200593441 Y:5107150-5107172 TTTCATCTTCATATATACAAAGG - Intronic
1201189354 Y:11433695-11433717 TTCCTTAGGGATATACCCAAGGG - Intergenic