ID: 1004953640

View in Genome Browser
Species Human (GRCh38)
Location 6:20702624-20702646
Sequence TATCGAGAGGACGTCCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 47}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004953640 Original CRISPR TATCGAGAGGACGTCCAGAG GGG (reversed) Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
906419353 1:45651258-45651280 TATCAAGGGGAAGTCAAGAGTGG - Intronic
907451057 1:54546187-54546209 TTACGAGAGGACTTCCAGAAAGG - Intronic
909549492 1:76881879-76881901 TATCAAAAGGAATTCCAGAGTGG + Intronic
910945383 1:92586069-92586091 TATCAAGAGGAATACCAGAGAGG + Intronic
917465338 1:175271116-175271138 TCTCAACAGGACTTCCAGAGAGG - Intergenic
1063034530 10:2272361-2272383 AATCTGGAGGACATCCAGAGGGG + Intergenic
1074450788 10:113558131-113558153 TATTGAGGGAACGTCCAGATGGG - Intronic
1078523546 11:12083443-12083465 TTTGGAGAGGACTCCCAGAGAGG - Intergenic
1082754145 11:57056024-57056046 TATCAAGAGGATGTCCTCAGTGG + Intergenic
1086676275 11:89610905-89610927 TATGAAGAGAAGGTCCAGAGTGG + Intergenic
1089659599 11:119977495-119977517 CAGGGAGAGGACGTCCAGAAGGG + Intergenic
1103343037 12:120231153-120231175 GATAGAGAAGACATCCAGAGAGG - Intronic
1108435702 13:50399449-50399471 TATCCAGAGGCTATCCAGAGGGG + Intronic
1117828633 14:59728405-59728427 TCTCGAGAGGAAGTGAAGAGAGG - Intronic
1119351910 14:73972940-73972962 CAGCCAGAGGAGGTCCAGAGAGG - Exonic
1138002844 16:53299876-53299898 TATAGAGAGGATTTCCAGAGTGG - Intronic
1140760934 16:78108214-78108236 TATCTAGAGGCCGTCGGGAGCGG - Intronic
1146290480 17:31603095-31603117 CATCGAGAGGACGTTAAGTGAGG - Intergenic
1154513317 18:15134158-15134180 TATGGAAAGCACATCCAGAGCGG + Intergenic
1156108192 18:33691217-33691239 TATGGAGAGGACATCCTGATAGG - Intronic
927944255 2:27125372-27125394 TATCTAGAGGGCCTCCAGAATGG - Intronic
928276702 2:29907666-29907688 TTTCCAGAGGACGTAGAGAGAGG - Intronic
934948295 2:98558047-98558069 TGTACAGAGGAAGTCCAGAGTGG + Intronic
938513565 2:131978769-131978791 TATGGAAAGCACATCCAGAGAGG + Intergenic
1172576848 20:36016073-36016095 TATTGAGAGGATGGCCACAGAGG - Intronic
1173019873 20:39258096-39258118 GATCCAGAGGACGTCCCAAGAGG - Intergenic
1177977877 21:27873143-27873165 TATGGAAAGCACATCCAGAGTGG - Intergenic
1181192159 22:21149717-21149739 TATCGAGAAAAGCTCCAGAGAGG - Intergenic
1181207036 22:21260792-21260814 TATCGAGAAAAGCTCCAGAGAGG + Intergenic
1181739779 22:24911643-24911665 TATCGAGAGGAAAACCACAGAGG - Intronic
963213030 3:142715356-142715378 TATCCAGAGGACTCCCATAGGGG - Intergenic
966663092 3:182437028-182437050 TATAGAGATGAGATCCAGAGAGG + Intergenic
970053358 4:11941679-11941701 TTTGGAGAGGACGCACAGAGAGG + Intergenic
976227324 4:82805810-82805832 TATGGACAGGACCTCCAAAGGGG + Intergenic
976860858 4:89664470-89664492 TTTTGAGAGGAAGTCCAGAAAGG + Intergenic
985011986 4:185592144-185592166 TATCGAGAGGGCTTCCAGTCTGG - Intronic
988635680 5:32981511-32981533 TTTCCAGAGGGCTTCCAGAGAGG - Intergenic
990562529 5:56997174-56997196 TAACTAGAGGACCTCCAGACTGG + Intergenic
1004953640 6:20702624-20702646 TATCGAGAGGACGTCCAGAGGGG - Intronic
1007228032 6:40328436-40328458 AATCGAGAGGCCCTCCAGCGAGG - Intergenic
1013017325 6:106171798-106171820 TATTGAGAGGAAGACCACAGAGG - Intergenic
1032258816 7:130318186-130318208 TTTGGAGAGGACGTCCTCAGAGG - Intronic
1032804526 7:135341140-135341162 TACCCAGAGGACGGCCAGAGTGG + Intergenic
1034553099 7:151833529-151833551 TATAGAGAGGAGAGCCAGAGCGG + Intronic
1052690431 9:31809446-31809468 CGTTGAGAGGATGTCCAGAGGGG - Intergenic
1061053596 9:128209915-128209937 AAGCCAGAGGAGGTCCAGAGAGG + Intronic
1061296982 9:129682113-129682135 CAGGGAGAGGAGGTCCAGAGTGG + Intronic
1193562501 X:83036414-83036436 TATAGAGAGGACGTACACATGGG + Intergenic
1198603681 X:138313202-138313224 TAGCAAGAGGAAGACCAGAGAGG + Intergenic