ID: 1004955380

View in Genome Browser
Species Human (GRCh38)
Location 6:20723048-20723070
Sequence TCTGGGTACCTGCAGTTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 8, 3: 26, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004955380_1004955388 16 Left 1004955380 6:20723048-20723070 CCCATCAACTGCAGGTACCCAGA 0: 1
1: 0
2: 8
3: 26
4: 176
Right 1004955388 6:20723087-20723109 CCCTTTGCCCTTTCCAGTGGAGG No data
1004955380_1004955386 13 Left 1004955380 6:20723048-20723070 CCCATCAACTGCAGGTACCCAGA 0: 1
1: 0
2: 8
3: 26
4: 176
Right 1004955386 6:20723084-20723106 AAGCCCTTTGCCCTTTCCAGTGG 0: 1
1: 0
2: 4
3: 38
4: 223
1004955380_1004955390 17 Left 1004955380 6:20723048-20723070 CCCATCAACTGCAGGTACCCAGA 0: 1
1: 0
2: 8
3: 26
4: 176
Right 1004955390 6:20723088-20723110 CCTTTGCCCTTTCCAGTGGAGGG 0: 1
1: 7
2: 14
3: 58
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004955380 Original CRISPR TCTGGGTACCTGCAGTTGAT GGG (reversed) Intronic
902271784 1:15310076-15310098 TCTCGAGACCTGCAGATGATAGG + Intronic
906251149 1:44311961-44311983 TTTGGGCACCTGCGGTAGATTGG - Intronic
907987302 1:59544628-59544650 TCCTGGTATCTGCACTTGATGGG - Intronic
915569512 1:156736779-156736801 TCTGGGCACTTTCAGATGATGGG - Exonic
917669070 1:177255776-177255798 TCTGGGCACCTCCAGCTGAGGGG + Intronic
920231073 1:204469878-204469900 TCTGGGCGCCTGCAGGTGAGGGG + Exonic
922913812 1:229239429-229239451 TCTGGGTACCCACACTTGGTGGG + Intergenic
923443098 1:234039994-234040016 TTTGGGTACCAGCACTTGGTGGG + Intronic
1063537672 10:6900897-6900919 TCTGGGTACCTGCACTTGGTGGG + Intergenic
1065969261 10:30793118-30793140 AATGGTTACCTGCAGTGGATTGG + Intergenic
1068500361 10:57835465-57835487 TCCTGATACCTGCAGCTGATTGG - Intergenic
1070973732 10:80588538-80588560 TCTGGGATTCTGCAGTGGATGGG - Intronic
1071149754 10:82620275-82620297 TTTGGGTACCTACACTTGGTGGG + Intronic
1074016595 10:109541198-109541220 TTGGGGTACCTGAAATTGATGGG - Intergenic
1075949366 10:126463564-126463586 TCTGGGGACCTGCAGAGGGTGGG - Intronic
1078080974 11:8204597-8204619 TCTGGGTATCAGCAGGTGACAGG - Intergenic
1079898236 11:26149055-26149077 AGTGGGCACCTGCAGTTGTTGGG + Intergenic
1080900797 11:36488683-36488705 TCTCAGAACCTGCAGTTGTTAGG + Exonic
1083788170 11:64966014-64966036 TTTGGGTTCCTGCGGTTGGTAGG - Intronic
1084643432 11:70439833-70439855 CCTCGGTACCTGCAGGGGATTGG + Intergenic
1084874993 11:72124505-72124527 TCTGGGTACCCACACTTGGTGGG + Intronic
1087602958 11:100339228-100339250 TCTGGGTACCTGCACTCGGTGGG + Intronic
1088091579 11:106046402-106046424 TCTGGGTATATGAAGTAGATAGG + Intergenic
1089604971 11:119636444-119636466 TCTGGGTCCCTGGAGCTGAGGGG + Intronic
1090293449 11:125566537-125566559 TCTGGGTACCTGTACTTGGTGGG + Intergenic
1090362710 11:126184656-126184678 TCTGGGTTCCTGCAGTTTCTGGG + Intergenic
1091285262 11:134405282-134405304 TCTGGGTCCCCGTAGCTGATGGG - Intronic
1093592311 12:20917538-20917560 TCTGGGTACCTGCATTCGGTGGG + Intergenic
1094114517 12:26895983-26896005 TCTGGGTAGCTTCAGTTCAATGG - Intergenic
1094423635 12:30297339-30297361 TCTGGGTAACTGGACTTGATGGG - Intergenic
1095199584 12:39367110-39367132 TCTGGGTACTGGCAGTTGTCCGG + Exonic
1097374058 12:58819408-58819430 TTTGTGTACCTGCACTTGGTGGG - Intergenic
1097746586 12:63310364-63310386 TTTGGGTACCTGCACTTGGTGGG + Intergenic
1098181919 12:67856382-67856404 TCTGGGATCCTGCCTTTGATGGG - Intergenic
1099005391 12:77229122-77229144 TCTTGGTACCTGCAAATAATAGG - Intergenic
1099967998 12:89471450-89471472 TCTGAGACCCTGCTGTTGATGGG + Intronic
1100480432 12:94972792-94972814 GCTGGATACCTGGAGTTGAAAGG + Intronic
1101530697 12:105570884-105570906 TCTGGATGTCTGCAGTTGCTTGG + Intergenic
1101609720 12:106279384-106279406 TCTGGGTACCTGCACTTGGTGGG + Intronic
1102230903 12:111261551-111261573 TCTGGGGACATGCAATTGAGTGG - Intronic
1103918661 12:124388557-124388579 TCTGGGCCCCTGGAGTGGATGGG - Intronic
1104056802 12:125236882-125236904 TTTGGGTACCTGTAGTGCATCGG + Intronic
1106798679 13:33233609-33233631 TCTGAGTACCTGCACTTGATGGG - Intronic
1107555083 13:41510440-41510462 TCTGGGAACCTCCAGGTGTTCGG + Intergenic
1110410156 13:75195936-75195958 TCTGGATTCCTGCAGCTAATGGG - Intergenic
1111485065 13:88887182-88887204 TCTCGCTACCTCCACTTGATGGG - Intergenic
1111625429 13:90778533-90778555 TCTGGGGACCTGGACTAGATAGG + Intergenic
1112311329 13:98319819-98319841 TCTGGATACCTACAGTTGCTGGG + Intronic
1112519182 13:100081048-100081070 TCCTGATACCTGCAGCTGATTGG - Intergenic
1114887569 14:26873002-26873024 TCTGTGCACCTGCATTTGATAGG + Intergenic
1114908660 14:27164128-27164150 TTTGAGTACCTGCACTTGGTAGG - Intergenic
1115123015 14:29959990-29960012 TCGGTGTACCTGAAATTGATGGG - Intronic
1117300779 14:54424815-54424837 TCTGGGTACATGAATTTGACTGG + Exonic
1117928591 14:60812934-60812956 TCTGGGTACCCACACTTGGTGGG - Intronic
1118240021 14:64047051-64047073 TCTGGGTACCCACACTTGGTGGG + Intronic
1118483859 14:66195684-66195706 TCTGGGTACCTGCACTTGGTGGG + Intergenic
1118647953 14:67858222-67858244 TCTGGGTACCCGCACTTGGTGGG + Intronic
1119876359 14:78062984-78063006 TCTGGGTACCTGCATGTGCCGGG + Intergenic
1122238415 14:100345836-100345858 TCTGGGTACCGCCACTTGGTGGG - Intronic
1124191423 15:27580412-27580434 TCTTGGTATCTGCAGGGGATTGG + Intergenic
1124555117 15:30718359-30718381 TCTGTGTCCCTGCAGTTAAAAGG + Intronic
1124655474 15:31503479-31503501 CCTGGCCACCTGCCGTTGATAGG + Intronic
1124676134 15:31687323-31687345 TCTGTGTCCCTGCAGTTAAAAGG - Intronic
1125533685 15:40430226-40430248 ACAGGGTACCTGCACATGATAGG - Intronic
1125733290 15:41906512-41906534 TCTGGGTACCTGCGTTTGGTGGG - Intronic
1126088336 15:45029668-45029690 TCTGGGTACCTGTACTTGGTGGG + Intronic
1129019604 15:72504365-72504387 TTTGGGTACCTGCACTTGGTGGG + Intronic
1130533232 15:84763827-84763849 TGTGGGTATATGTAGTTGATGGG + Intronic
1131748759 15:95481974-95481996 TAAGGGTACATGAAGTTGATGGG - Intergenic
1132568688 16:634789-634811 TCTGGGTTCCTGCAGAGGGTGGG + Exonic
1134181922 16:12054695-12054717 TCTTGGTCCCTGCAGTTGTGTGG + Intronic
1135399521 16:22156557-22156579 TCTGGGGACCTGCAGATCCTGGG - Exonic
1139111100 16:63891790-63891812 TCTGGCTACCGGAAGTTGTTGGG + Intergenic
1141172621 16:81700833-81700855 TCTGGGTACCTAGAGGTGCTGGG + Intronic
1143706749 17:8703376-8703398 TCTGGGTACCTGCACTTGGTGGG + Intergenic
1144122268 17:12166505-12166527 CATGGGTAACTCCAGTTGATAGG + Intergenic
1146745289 17:35323508-35323530 TTTGGGTACCTGCACTTGGTGGG + Intergenic
1147587286 17:41659791-41659813 TCTGGGTACCTGCTGGGGCTGGG - Intergenic
1148910082 17:50937576-50937598 TCTTTGTAACTCCAGTTGATAGG - Intergenic
1151018474 17:70584679-70584701 TCTGGGTACCCGCACTCGGTGGG + Intergenic
1155839063 18:30625433-30625455 TTTGAGTACCTGCACTTGGTGGG + Intergenic
1156946899 18:42844340-42844362 TCTGGGTACCTGAACTTGGTGGG + Intronic
1157220320 18:45824892-45824914 TCTGGGGACTCGCAGCTGATTGG + Intergenic
1157491123 18:48124571-48124593 TCTGGGCACCTGCAGGGGTTTGG + Intronic
1158565228 18:58549452-58549474 TCTGGGAAGCTGAAGTTGGTAGG + Intronic
1159069324 18:63605801-63605823 TCTGGGTACCTGAAGAAGACTGG + Intergenic
1159590760 18:70332687-70332709 CCTGGGTATCTGCAGGGGATTGG + Intergenic
1162951526 19:14074256-14074278 CCTGGGTGCCTGGAGTTGAATGG + Intronic
1163605697 19:18274226-18274248 TCTGGGTGACTGCAAATGATGGG - Intronic
1164197157 19:22979389-22979411 TCGGGGTACCTGAAAGTGATGGG + Intronic
1164541850 19:29127414-29127436 TCTGGTGACCTGAAGTTCATGGG - Intergenic
1165022924 19:32938377-32938399 TGTGCTTCCCTGCAGTTGATGGG - Intronic
1165159263 19:33806251-33806273 TCTGGGTGCCTGGTGTTGACAGG + Intronic
1167808495 19:51807472-51807494 TTCGGGTCCCTGCAGTTGATAGG + Intronic
927217556 2:20676659-20676681 GGTGGGTACCTGCAGGTCATGGG - Intergenic
927618786 2:24629052-24629074 TTTGGGTAGCAGCAGTTGAATGG + Intronic
928061257 2:28115774-28115796 TGTGGGAACCTGCAGTAGTTAGG + Intronic
929954332 2:46443948-46443970 TCTGGGTACCTACAGCTCCTGGG + Intronic
930090156 2:47525949-47525971 TCAGGGGACCCGCAGTGGATGGG - Intronic
933875266 2:86614195-86614217 TCTGGGGACATGCACTTAATAGG + Intronic
936858421 2:116987553-116987575 TTTGGGTACCTGCACTTGTTGGG - Intergenic
937417965 2:121732044-121732066 CCTGGGTGCCTGCTGTTGGTGGG - Intronic
945592240 2:211747849-211747871 TCTTGGTATCTGCAGTAAATTGG + Intronic
948324104 2:237097687-237097709 TCTGGCTAACTGCTGTTCATTGG - Exonic
1169192822 20:3668791-3668813 TCTGGGTTCCTGGAGTGGGTGGG + Exonic
1172363629 20:34332438-34332460 TCAGGGTACCCGCACTTGGTGGG - Intergenic
1172941370 20:38656847-38656869 TGGGGCTACCTGCAGTTGTTGGG - Intergenic
1173811308 20:45957535-45957557 GCTGGGTACCTGCGGTAGCTGGG + Intronic
1174681050 20:52408749-52408771 TCTTGGTACCTGCAGATAAAAGG + Intergenic
1177522989 21:22254332-22254354 TCTTGTTACCTGTAGTGGATTGG - Intergenic
1178071427 21:28972324-28972346 CCTTGGTACCTGCAGGGGATTGG + Intronic
1178440409 21:32593802-32593824 TCTGTGTGCCTGCTGTGGATGGG - Intronic
1181363100 22:22353968-22353990 ACTGGGTACCTGCATTTCAGTGG + Intergenic
1181365913 22:22377044-22377066 CCTGGGTACCTGCATTTCAGTGG + Intergenic
1181372348 22:22428566-22428588 CCTGGGTACCTGCATTTCAGTGG + Intergenic
1181439866 22:22930235-22930257 CCTGGGAAACTGCAGCTGATTGG - Intergenic
1181628404 22:24136951-24136973 TCTGTTTTTCTGCAGTTGATAGG + Intronic
1181856004 22:25781977-25781999 TCTGGGTACACGCAGCTCATGGG + Intronic
1182791191 22:32954394-32954416 TTTTGCTACCTGCAGTGGATAGG + Intronic
1185055780 22:48577586-48577608 TCTGGGTTCCTGCAGAGGAAGGG + Intronic
1185379065 22:50498710-50498732 TCAGGGTCCCCGCAGGTGATTGG - Intergenic
949507663 3:4742161-4742183 TCTGGAGGCCCGCAGTTGATAGG - Intronic
951239513 3:20272447-20272469 TCTTGATATCTGCAGCTGATTGG - Intergenic
955948932 3:64222643-64222665 TCTGGGTGCCTTCAGCTTATGGG - Intronic
956334251 3:68145578-68145600 TCTGGCTAACTGCTGTTCATTGG - Intronic
957121024 3:76092585-76092607 TCTGGGTACCCGCAGTTAACAGG + Intronic
958973390 3:100638183-100638205 TTTGGGTACCTGCACTTGGTGGG + Intronic
959963308 3:112325951-112325973 TCTGGGTAAGTGCAGTTATTAGG - Intergenic
961556922 3:127702185-127702207 TCTGGGCCACTGCAGTTGATGGG + Intronic
961598902 3:128043388-128043410 TCTGGGTACTGGCACTTGGTGGG + Intergenic
963215109 3:142737423-142737445 TCTGGATAGCTGAAGTTGCTGGG - Intronic
965039688 3:163490458-163490480 TCTGGGTATCAGCACTTGGTGGG + Intergenic
965604307 3:170484040-170484062 TCTGGGTCCCAACAGTTAATAGG - Intronic
966105658 3:176330374-176330396 TATTGGTACTTGCAGTTGTTTGG - Intergenic
967108987 3:186276534-186276556 TCTGCGTACCGAAAGTTGATAGG - Intronic
971801506 4:31298786-31298808 GGTGGGTATCTGCTGTTGATGGG + Intergenic
979297973 4:119054369-119054391 TTTGGGTACCTGCACTCGGTGGG + Intronic
979656887 4:123205700-123205722 TCTTGGTATCTGCAGAGGATTGG - Intronic
980299720 4:130973033-130973055 TCTGGGTACCTGCACTTGGTAGG - Intergenic
981303712 4:143222296-143222318 CCTTGGTATCTGCAGTGGATTGG + Exonic
983407876 4:167353610-167353632 TCTGGGTAGATACAGGTGATGGG + Intergenic
984229303 4:177075120-177075142 TTTGGGTACCTGCACTCGGTAGG + Intergenic
988603565 5:32661534-32661556 TTTGGGTACCCACATTTGATAGG + Intergenic
989319767 5:40121110-40121132 TCTGGATACCTGCACTTGGTGGG - Intergenic
991294258 5:65064083-65064105 TCGGGGTAAATGCTGTTGATAGG + Intergenic
992000098 5:72428015-72428037 TCTGTCTCCCTGCAGCTGATTGG + Intergenic
993167675 5:84378387-84378409 ACTGGGTACATGCAGTTGGGAGG - Intronic
993404901 5:87499586-87499608 TCTGAGTACCTGCACTTGGTGGG - Intergenic
996250157 5:121319246-121319268 TCTGGGTACCCTCACTTGGTGGG - Intergenic
999276491 5:150334085-150334107 TCTGGTTGCCTACAGTTTATGGG - Intronic
999924568 5:156360893-156360915 TCTGGGTACCTACTCTTGGTGGG - Intronic
1001973751 5:175979458-175979480 TCTGGGTACCCACACTTGGTGGG - Intronic
1002243681 5:177864321-177864343 TCTGGGTACCCACACTTGGTGGG + Intergenic
1003805812 6:9725075-9725097 TCCTGGTATCTGCAGCTGATCGG - Intronic
1004955380 6:20723048-20723070 TCTGGGTACCTGCAGTTGATGGG - Intronic
1006184277 6:32171497-32171519 TCTGGCCACCTGCAGGGGATGGG + Exonic
1006478493 6:34273326-34273348 TATGGGGACTTGCAGTTTATGGG - Intergenic
1006767342 6:36519444-36519466 TCTGGCTCCCTGCAGTAGGTAGG - Intronic
1006875295 6:37290259-37290281 TGTGAGTACATGCAGATGATAGG - Intronic
1007717287 6:43864649-43864671 TCTGGGTCCCTGCCCTTGCTGGG + Intergenic
1014107425 6:117582854-117582876 TTTGGGTACCTGCACTTGGTGGG - Intronic
1014584748 6:123183994-123184016 TTGGGGTACCTGAAGGTGATGGG + Intergenic
1015932426 6:138374991-138375013 TTTGGGTACCTTCACTTGGTGGG + Intergenic
1016082976 6:139878263-139878285 TCTGGGTACCTGCATTGGGTGGG + Intergenic
1016873381 6:148840509-148840531 TCTCGGTATCTGCAGGGGATTGG + Intronic
1018824533 6:167399148-167399170 TCTGTGTGCCTGCTGTGGATGGG - Intergenic
1019609216 7:1928495-1928517 TCTAGGGACCTGCAGGTCATGGG - Intronic
1021386370 7:20035651-20035673 TCTGGGTACCTGCACTTGGTGGG + Intergenic
1022168491 7:27797888-27797910 TCTAGGTACGTGCAATTCATTGG - Intronic
1022304535 7:29134314-29134336 ACTGGCTCCCTGCAGTTGATTGG - Intronic
1024045107 7:45580496-45580518 TCTGGGAAGCTGCAGTCTATTGG + Intronic
1024164197 7:46714007-46714029 ACTGGGTAGTTGCAGTTTATGGG - Intronic
1025027018 7:55524975-55524997 TCTGCGTGCCTGCTGGTGATTGG - Intronic
1032422007 7:131789506-131789528 TCTGGGTATCTGCAGTGAGTTGG + Intergenic
1032623776 7:133565863-133565885 TCTGGATACCTGCAGCTGGATGG + Intronic
1034124537 7:148659311-148659333 CCTTGGTATCTGCAGTGGATGGG - Intergenic
1035718228 8:1770263-1770285 TCTGGGTCTCTGCAGCTGCTGGG - Intronic
1036083777 8:5590173-5590195 TCTCTGTACCTGAAGTTGAAAGG - Intergenic
1036202906 8:6784269-6784291 TTTGGGGACCTGCAGTGGGTTGG + Intergenic
1037762167 8:21748856-21748878 TCTGGGGAGCTGCAGGTGTTGGG - Intronic
1038049833 8:23798223-23798245 TCTGTGTACGTGCAGTTCCTTGG + Intergenic
1038271935 8:26082214-26082236 TCTGGGAACCTGAAGTTGGAAGG + Intergenic
1038421976 8:27439326-27439348 TCTGGGGACATCCATTTGATGGG - Exonic
1038705330 8:29888250-29888272 TCTGGATATCTGCACTTGACTGG - Intergenic
1039444290 8:37618595-37618617 TCTGGGTACCTACAGTTCCCTGG + Intergenic
1040667852 8:49654225-49654247 TCCTGGTATCTGCAGCTGATTGG + Intergenic
1042855874 8:73266754-73266776 TCTGGGCGCCTGCAGTTCAGTGG - Intergenic
1042930694 8:74011109-74011131 TCTGGTTATCTGAAGTTGAATGG + Intronic
1044031278 8:87240966-87240988 TGTGGGTCCCCCCAGTTGATGGG + Intronic
1047785920 8:128153744-128153766 TCAGGGAACTTGCAGTTTATTGG + Intergenic
1048407577 8:134138930-134138952 TGTGGGTAATTGCAGTTGACAGG - Intergenic
1050751714 9:8946521-8946543 TCTTGGTAGCTGTAGCTGATGGG + Intronic
1050792842 9:9495761-9495783 TTTGGGTACCTGCACTCAATGGG - Intronic
1052218596 9:25995172-25995194 TCTGAGGTCCTGCAGTTGAGGGG - Intergenic
1055708447 9:79033542-79033564 TTTGGGTACCTGCACTTGGTGGG + Intergenic
1057262810 9:93595000-93595022 CCTGAGTACCTGCTGGTGATTGG - Intronic
1058232287 9:102442023-102442045 TCTTGGTATCTGCAGGGGATTGG - Intergenic
1059995304 9:119903063-119903085 TCAGGGTTCCTGCAGGTGGTAGG + Intergenic
1186311416 X:8323495-8323517 TCTGGGTACCTGCAGTCAATAGG - Intergenic
1188182710 X:27075453-27075475 TTTGGGTACCTGCATTTGGTGGG - Intergenic
1188526989 X:31097600-31097622 TTTGGGTACCAGCACTTGGTGGG + Intergenic
1189032645 X:37466005-37466027 TTTGTGTACCTGCAGTAGTTTGG + Intronic
1189676713 X:43468093-43468115 TCTGGGTATCTGCACTCGGTGGG + Intergenic
1190131396 X:47751925-47751947 TATGGGTACCTGCACTAGGTGGG + Intergenic
1193341717 X:80355942-80355964 TCCCAGTACCTGCAGTTCATGGG + Intronic
1195532535 X:105973099-105973121 CCTGGGTGCCTGGTGTTGATGGG + Intergenic
1197495578 X:127174614-127174636 TCTGGGTACCTGCACTCAGTGGG + Intergenic
1199342000 X:146691494-146691516 CCTTGGTATATGCAGTTGATTGG + Intergenic
1201487593 Y:14509096-14509118 TCCTGATATCTGCAGTTGATTGG - Intergenic
1201729587 Y:17189860-17189882 TCTTGATATCTGCAGCTGATTGG + Intergenic
1201989503 Y:20008708-20008730 TCTTGATATCTGCAGCTGATTGG + Intergenic