ID: 1004955887

View in Genome Browser
Species Human (GRCh38)
Location 6:20727164-20727186
Sequence AAACAGTTACCTGTGGGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 205}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004955887_1004955895 13 Left 1004955887 6:20727164-20727186 CCTTGACCCACAGGTAACTGTTT 0: 1
1: 0
2: 4
3: 64
4: 205
Right 1004955895 6:20727200-20727222 GTCTGTCTTAGTTGATTAAGGGG 0: 1
1: 6
2: 9
3: 32
4: 124
1004955887_1004955894 12 Left 1004955887 6:20727164-20727186 CCTTGACCCACAGGTAACTGTTT 0: 1
1: 0
2: 4
3: 64
4: 205
Right 1004955894 6:20727199-20727221 GGTCTGTCTTAGTTGATTAAGGG 0: 1
1: 5
2: 9
3: 31
4: 111
1004955887_1004955890 -10 Left 1004955887 6:20727164-20727186 CCTTGACCCACAGGTAACTGTTT 0: 1
1: 0
2: 4
3: 64
4: 205
Right 1004955890 6:20727177-20727199 GTAACTGTTTCCTTAACTTTAGG 0: 1
1: 2
2: 3
3: 21
4: 245
1004955887_1004955891 -9 Left 1004955887 6:20727164-20727186 CCTTGACCCACAGGTAACTGTTT 0: 1
1: 0
2: 4
3: 64
4: 205
Right 1004955891 6:20727178-20727200 TAACTGTTTCCTTAACTTTAGGG 0: 1
1: 0
2: 2
3: 54
4: 324
1004955887_1004955893 11 Left 1004955887 6:20727164-20727186 CCTTGACCCACAGGTAACTGTTT 0: 1
1: 0
2: 4
3: 64
4: 205
Right 1004955893 6:20727198-20727220 GGGTCTGTCTTAGTTGATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004955887 Original CRISPR AAACAGTTACCTGTGGGTCA AGG (reversed) Intronic
902964230 1:19986744-19986766 ACACAGTTACCTACGGGCCATGG - Intergenic
904523796 1:31116456-31116478 AAAAGGTTACCAGGGGGTCAGGG - Intergenic
905968935 1:42125681-42125703 TAATAGTTACCTTTGGGTGAAGG + Intergenic
906830574 1:49027311-49027333 AAAAAATTAGCTGTGTGTCATGG - Intronic
907150182 1:52278553-52278575 AAACAAATACAAGTGGGTCAGGG - Exonic
907447553 1:54518510-54518532 CAACAGCTACATGTGGCTCATGG - Intergenic
907736252 1:57115593-57115615 AAATAGTCACCTGTGGCTAATGG + Intronic
907754022 1:57292317-57292339 AAACAGATACCTTTGGATTAAGG - Intronic
908185718 1:61651038-61651060 AGACACATAACTGTGGGTCAAGG - Intergenic
910402211 1:86848423-86848445 AGACAGTTACCTGCATGTCAAGG + Intergenic
912664560 1:111567544-111567566 ATACAGTTACCTTTGGGGCTAGG - Intronic
913291047 1:117272272-117272294 CAAAAGTTACCTGTGAGTCAAGG - Intergenic
913703088 1:121393010-121393032 AAAGAGTTACCTGTGGATAAAGG + Intergenic
913939814 1:125090923-125090945 AAAGAGTTACCTGTGGATAAAGG - Intergenic
913979260 1:143494174-143494196 AAAGAGTTACCTGTGGATAAAGG + Intergenic
914043650 1:144073508-144073530 AAAGAGTTACCTGTGGATAAAGG + Intergenic
914073663 1:144319824-144319846 AAAGAGTTACCTGTGGATAAAGG + Intergenic
914105492 1:144646536-144646558 AAAGAGTTACCTGTGGATAAAGG - Intergenic
914134437 1:144886983-144887005 AAAGAGTTACCTGTGGATAAAGG - Intergenic
914312546 1:146479366-146479388 CAAAAGTTACCTACGGGTCAAGG + Intergenic
914501802 1:148253972-148253994 CAAGAGTTACCTACGGGTCAAGG - Intergenic
914929614 1:151919385-151919407 ACAAAATTACCTATGGGTCAAGG + Intergenic
915210047 1:154301875-154301897 AAACAATTTCCTGTGGCTGATGG + Intergenic
915454891 1:156033689-156033711 AAAAAATTACCTGGGTGTCATGG + Intergenic
915696675 1:157749907-157749929 AAACAGTTACCAGTGCATGACGG - Intronic
917916031 1:179702974-179702996 CAAAAGTTACCTACGGGTCAAGG + Intergenic
918156046 1:181847773-181847795 AAATAGTTACCTGTGGCTAGGGG - Intergenic
918598947 1:186330177-186330199 CAAAAGTTACCCGTAGGTCAAGG + Intronic
919914838 1:202132917-202132939 AACCAGTTAACTGTGCTTCAGGG - Exonic
923065219 1:230511117-230511139 CAAAAGTTACCTATGGGACAAGG - Intergenic
923249710 1:232168534-232168556 CAAAAGTTACCTGCAGGTCAAGG + Intergenic
924151401 1:241134088-241134110 AAACAGTCACATGTGGCTAATGG - Intronic
1063121700 10:3109327-3109349 AACCAGGTCCATGTGGGTCAGGG - Intronic
1063597511 10:7450215-7450237 AAACAGTTGCCTGGAGGTCTGGG - Intergenic
1065062964 10:21926728-21926750 AAAGAGTTACTTGTGCCTCAAGG + Intronic
1066780322 10:38938867-38938889 AAAGAGTTACCTGTGGATAAAGG + Intergenic
1066956067 10:42174149-42174171 AAAGAGTTACCTGTGGATAAAGG + Intergenic
1067030137 10:42874386-42874408 ATACAGTGAACTGTGGGCCATGG + Intergenic
1069502136 10:68963457-68963479 AGACAGTTACCTGAGGGGCACGG - Exonic
1072065551 10:91866945-91866967 AAACAGATTCCTGTGGGTTAGGG - Intergenic
1073433937 10:103504785-103504807 AAACAATTATCTCTGGGTAAAGG + Intronic
1075275259 10:121087005-121087027 AAACAGATACAAGTGGATCAGGG - Intergenic
1076347261 10:129787972-129787994 AAACTGTTCCCTCTGGGCCAAGG + Intergenic
1078183262 11:9030036-9030058 GAACATTGAACTGTGGGTCAAGG + Exonic
1082022557 11:47546912-47546934 AAAAAATTAGCTGGGGGTCATGG + Intronic
1082745882 11:56962508-56962530 AGACAGTTACATGTGTGCCATGG + Intergenic
1087846342 11:102977813-102977835 TAACGGTCACCTTTGGGTCAGGG + Intergenic
1088775099 11:113074969-113074991 AAACAGCTTCATGTGGCTCATGG + Intronic
1089439683 11:118504985-118505007 AAACAGGTACCTGAAGGCCAGGG - Exonic
1089913338 11:122126171-122126193 AAACACTGACCTCTGGGTAAGGG - Intergenic
1089919451 11:122194496-122194518 AAACAATTAGCTGTGTGTGATGG + Intergenic
1090461912 11:126898689-126898711 GAATAGTTACCTGGGGGTAAAGG + Intronic
1094363114 12:29651320-29651342 AAACAGTTGGTGGTGGGTCAGGG + Intronic
1095492366 12:42748060-42748082 AAAGAGTTACCTGTTTGTGATGG - Intergenic
1101375641 12:104169003-104169025 AAACAGATACCAGTTGCTCAAGG + Intergenic
1103529596 12:121591631-121591653 AAAAAGTTACCAGAGGGTCAAGG + Intergenic
1105444314 13:20439260-20439282 ACACAGTTACTTGGGGGTGAAGG + Intronic
1109384057 13:61604341-61604363 AAAAAGTTACCTATGGGTCAAGG - Intergenic
1109412036 13:61982837-61982859 ATTCAGTTACCTGTGGTTCCAGG - Intergenic
1111306942 13:86426938-86426960 ACACAGGTAACTGTGTGTCATGG + Intergenic
1114830384 14:26134224-26134246 AAACAGGCCCTTGTGGGTCAGGG + Intergenic
1117439519 14:55746528-55746550 CAAAAGTTACCTGTGGGTAGAGG + Intergenic
1118681934 14:68250739-68250761 AACCAGATACCTGAGGGTCTGGG + Intronic
1202936931 14_KI270725v1_random:97236-97258 AAAGAGTTACCTGTGGATAAAGG - Intergenic
1123392945 15:19895962-19895984 AAAGAGTTACCTGTGGATAAAGG + Intergenic
1123396269 15:19940522-19940544 AAAGAGTTACCTGTGGATAAAGG + Intergenic
1124009071 15:25821234-25821256 AAAAAGTTACCTGGGTGTCATGG + Intronic
1125355955 15:38817732-38817754 AAACAGATTCCTGTGTGTCAAGG + Intergenic
1126778022 15:52116207-52116229 AAACAGTGACCTCTGCTTCATGG + Exonic
1128001671 15:64198498-64198520 AAACTGTATCCTGTGGGCCAGGG - Intronic
1128227894 15:66015137-66015159 ACACAGTTATCTGTGGACCAGGG + Intronic
1132202564 15:99964934-99964956 GAACGGTTCCCTGTAGGTCATGG + Intergenic
1133510601 16:6453740-6453762 AAACAGTCACATGGGGCTCATGG - Intronic
1133873733 16:9713655-9713677 AAACTGTGGCCTGTGGGTCCAGG + Intergenic
1136698745 16:32112674-32112696 AAAGAGTTACCTGTGGATAAAGG + Intergenic
1136738086 16:32481653-32481675 AAAGAGTTACCTGTGGATAAAGG - Intergenic
1136768859 16:32815155-32815177 AAAGAGTTACCTGTGGATAAAGG - Intergenic
1136799249 16:33055973-33055995 AAAGAGTTACCTGTGGATAAAGG + Intergenic
1136901732 16:34047197-34047219 AAAGAGTTACCTGTGGATAAAGG + Intergenic
1136956927 16:34798922-34798944 AAAGAGTTACCTGTGGATAAAGG + Intergenic
1139382332 16:66540872-66540894 TAATAGTTGCCTGTGGCTCATGG - Intronic
1140350625 16:74258695-74258717 AAACACTTACTTTTTGGTCATGG - Intergenic
1141330689 16:83108290-83108312 AAACATTTACAGGTGGGGCATGG - Intronic
1142333584 16:89472030-89472052 AAGTAGTCACCTGAGGGTCAAGG - Intronic
1203014987 16_KI270728v1_random:347924-347946 AAAGAGTTACCTGTGGATAAAGG + Intergenic
1203033322 16_KI270728v1_random:621082-621104 AAAGAGTTACCTGTGGATAAAGG + Intergenic
1203071276 16_KI270728v1_random:1077266-1077288 AAAGAGTTACCTGTGGATAAAGG - Intergenic
1143740918 17:8953500-8953522 ACACATTAGCCTGTGGGTCACGG - Intronic
1144272046 17:13626977-13626999 AAATAGTTACATGTGGATAATGG - Intergenic
1144994503 17:19258093-19258115 AACCAGTTAGATGTGGGTGAGGG + Intronic
1145692898 17:26762926-26762948 AAATAGTTACCTGTGGATAAAGG + Intergenic
1145709631 17:26959548-26959570 AAAGAGTTACCTGTGGATAAAGG + Intergenic
1146202632 17:30873258-30873280 AAACAGCTAACTGTAGGTCTGGG - Intronic
1146597008 17:34178169-34178191 TGACAGTCACCTGTGGGTGAGGG - Intergenic
1147574536 17:41591164-41591186 AAAAAGTTAGCTGAGCGTCATGG + Intergenic
1148368691 17:47076993-47077015 AAACAGTTAACTGTCGGGCCGGG + Intergenic
1151927263 17:77207602-77207624 AAACAATTAGCTGTGGGTAGTGG - Intronic
1152768492 17:82153554-82153576 ACACAGTGACCTGGGGGGCAGGG + Intronic
1153509461 18:5836002-5836024 AAACAGTTACCTATTGGTCAAGG + Intergenic
1153826038 18:8875678-8875700 AATCAGTTCCCTGTGGCTGAGGG + Intergenic
1153889962 18:9503704-9503726 AAAAAGTGTCCTGTGGGTGAGGG - Intronic
1154518635 18:15201199-15201221 AAAGAGTTACCTGTGGATAAAGG - Intergenic
1155228002 18:23747070-23747092 AATCTGTTGCCTGGGGGTCAGGG + Intronic
1156163455 18:34388055-34388077 AAACAGTTACTTGTGAGTTGTGG + Intergenic
1156445377 18:37232875-37232897 GAACAGTAACCTCTGGGTCAGGG + Intergenic
1156735287 18:40250297-40250319 ATGTAGTTACCTGTTGGTCATGG - Intergenic
1156767006 18:40668872-40668894 ATACATTTATCTGTTGGTCATGG - Intergenic
1157490169 18:48117653-48117675 AAAGAGTTACCTCTGGCTGAGGG - Intronic
1158772332 18:60534433-60534455 AACCACTTACCTGTGGTTAATGG - Intergenic
1159293722 18:66454343-66454365 AAAAAGTTACCTACGTGTCAAGG - Intergenic
1160133208 18:76247904-76247926 AAATAGTTACATGTGGCTAATGG + Intergenic
1161510424 19:4667642-4667664 ATTCAGTTACTTGTGGTTCAGGG - Intronic
1162075874 19:8186951-8186973 AAAAAGTTATATGTGGGTCCAGG + Intronic
1163704885 19:18806604-18806626 CAAAAGTTACCTGGGCGTCATGG - Intergenic
1163960319 19:20683750-20683772 AAAAAGCTACCTGTGTGTGATGG - Intronic
1165174133 19:33914677-33914699 CAAAAGTTACCTATGGGTCGAGG + Intergenic
1167639905 19:50675337-50675359 CAACAGTTACCTGTGGCTGGTGG + Intronic
1202682890 1_KI270712v1_random:25839-25861 AAAGAGTTACCTGTGGATAAAGG + Intergenic
925665492 2:6250851-6250873 AAACAGTTAGCTGGGGGTGGTGG + Intergenic
925976688 2:9146685-9146707 AGACAGTGGCCTGTGGGTCTTGG - Intergenic
926135219 2:10331433-10331455 AAACGGTGTCCTGTGGGACAAGG - Intronic
926221646 2:10939961-10939983 CAAAAGTTACCTGTGAGCCAAGG + Intergenic
930222678 2:48761098-48761120 AAACAGTATCCTGTGGTACAAGG - Intronic
930709620 2:54537958-54537980 AAACAGTTCCATGTGGTTCCAGG - Intronic
930740021 2:54822738-54822760 AAGCAGTTATCTCTGGGTAATGG + Intronic
933744717 2:85562079-85562101 AAAAAGTTAGCTGTGTGTCGTGG + Intronic
934189271 2:89770936-89770958 AAAGAGTTACCTGTGGATAAAGG - Intergenic
934248907 2:90329335-90329357 AAAGAGTTACCTGTGGATAAAGG - Intergenic
934260672 2:91474145-91474167 AAAGAGTTACCTGTGGATAAAGG + Intergenic
934303989 2:91806092-91806114 AAAGAGTTACCTGTGGATAAAGG + Intergenic
934329265 2:92046658-92046680 AAAGAGTTACCTGTGGATAAAGG - Intergenic
934467483 2:94276580-94276602 AAAGAGTTACCTGTGGATAAAGG - Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
937177048 2:119948864-119948886 AAAAAGTTAACAGTGGGTAATGG + Intronic
938518624 2:132041694-132041716 AAAGAGTTACCTGTGGATAAAGG - Intergenic
939221043 2:139301825-139301847 AAATGGTTACATCTGGGTCAAGG - Intergenic
940111225 2:150156509-150156531 CAACTGTTACCTTGGGGTCAGGG + Intergenic
942295978 2:174517632-174517654 AAACAGGTGGCTGTGGGGCATGG - Intergenic
943805469 2:192120072-192120094 CAAAAGTTTCCTATGGGTCAAGG + Intronic
945994299 2:216423028-216423050 AAACAGTAACCTGTGAGGTAGGG + Intronic
947205579 2:227658137-227658159 AAAAAATTACCTGTGGGTGCTGG + Intergenic
948630282 2:239298051-239298073 GAAGAGATACCTGTGTGTCATGG + Intronic
1169189509 20:3648979-3649001 AACCAGATGGCTGTGGGTCATGG - Exonic
1169619369 20:7487933-7487955 AAAGAGTTAGCTATGGCTCATGG - Intergenic
1171485940 20:25486112-25486134 GAACAGTTGCATGTGGGTAAAGG + Intronic
1173319350 20:41973641-41973663 CAACAGCTTGCTGTGGGTCAGGG + Intergenic
1174171926 20:48623091-48623113 TGACAGTTTCCTCTGGGTCATGG - Intergenic
1176586386 21:8591741-8591763 AAAGAGTTACCTGTGGATAAAGG + Intergenic
1176743090 21:10624459-10624481 AAAGAGTTACCTGTGGATAAAGG + Intergenic
1177023098 21:15887413-15887435 AAACAATGACCTGTGATTCATGG - Intergenic
1177521512 21:22233909-22233931 AAGTAGTTACCTGTGGATGATGG - Intergenic
1178377873 21:32083046-32083068 AAGTAGTTACCTGTGGGGGAGGG + Intergenic
1180269194 22:10568644-10568666 AAAGAGTTACCTGTGGATAAAGG + Intergenic
1180534320 22:16383804-16383826 AAAGAGTTACCTGTGGATAAAGG + Intergenic
1181559164 22:23689898-23689920 AAACAGTTACATTTGGGGAAGGG + Intronic
1182521587 22:30887780-30887802 AAACTGTTGCCAGTGGGTGATGG - Intronic
1183122266 22:35739175-35739197 AAACAGGTACCTTTGGGGCATGG - Intronic
1203289540 22_KI270735v1_random:20994-21016 AAAGAGTTACCTGTGGATAAAGG - Intergenic
1203315323 22_KI270737v1_random:1992-2014 AAAGAGTTACCTGTGGATAAAGG - Intergenic
950865808 3:16188215-16188237 AAAGTGTTGCCTGTGGGTGAAGG + Intronic
951065677 3:18262517-18262539 AAAAAATTACCTGTGGTTTATGG + Intronic
952195094 3:31067169-31067191 AAGCAGCAACCTGTGAGTCAGGG + Intergenic
952326332 3:32323534-32323556 AAACAGTTACCTGTTGTTCTTGG + Intronic
952832585 3:37577279-37577301 AAACAATTAACTGAGGCTCAAGG - Intronic
953181918 3:40603732-40603754 AAACAGGTAGCTGTGTGTAAAGG - Intergenic
954020785 3:47739475-47739497 GAACAGTTACCTGAGTGTGATGG - Intronic
955199775 3:56840498-56840520 AAACAATGAACTGTGGCTCAGGG - Intronic
955396742 3:58563003-58563025 AAATGGATATCTGTGGGTCAGGG + Intergenic
956080232 3:65549398-65549420 AAACCGTTACCTGCGGGCCCCGG + Intronic
957452871 3:80402216-80402238 AAATGGCTACCTGGGGGTCAGGG + Intergenic
959573114 3:107906779-107906801 AAACAGTCTCCTCTGGCTCAAGG - Intergenic
961467748 3:127091776-127091798 AAGCAGTTTCCTGTGGGTGTCGG + Intergenic
962866061 3:139448818-139448840 AAACAGTTTCCCCTGGGTCTTGG - Intergenic
963381253 3:144533350-144533372 AAAAAATTACCTGTTGGTTATGG + Intergenic
964020003 3:151998648-151998670 AAACATTTACCTAAGGGGCAAGG - Intergenic
965272891 3:166641126-166641148 AAACAGTGTGCCGTGGGTCATGG - Intergenic
965975779 3:174620077-174620099 AAACAGTTACCTGTGGATCGGGG - Intronic
966679536 3:182626822-182626844 ATACAGTTACCTGTCACTCAAGG + Intergenic
966872710 3:184301781-184301803 AAGCACTTCTCTGTGGGTCAAGG - Intronic
968769272 4:2493438-2493460 ACACAGGTAGCTGTGGGACATGG + Intronic
970713509 4:18892844-18892866 AAACAGTAAACTGTGGATCAGGG - Intergenic
972745692 4:41930423-41930445 ATACAGTTGCCTGAGGGTTAGGG - Intergenic
974824520 4:67110327-67110349 AAAAATTTACCTGTGAGGCAAGG + Intergenic
974906959 4:68069939-68069961 AAACAGTTAATTGTGGGTTTTGG + Intronic
975124435 4:70766140-70766162 AACAAGTTACCTGGGGGTAAAGG - Intronic
975955072 4:79827103-79827125 CAACAGTTATCTGTGGCTCCAGG + Intergenic
980486942 4:133470591-133470613 AAACATTTACCTTAGGGTCATGG + Intergenic
982764335 4:159326728-159326750 AAAGAGGTACATGTGGGTAATGG - Intronic
983235773 4:165177904-165177926 GAACAGTGACCTGTTTGTCAGGG - Intronic
983637902 4:169916807-169916829 AAAGAGCTACCTTTGGCTCAAGG + Intergenic
985183100 4:187286874-187286896 CAAAAGTTACCTATGGGTCGAGG - Intergenic
985636104 5:1036546-1036568 CCACAGCTACCTGTTGGTCATGG + Intronic
989259313 5:39401444-39401466 AAACAGTTAACTTTGGGTAGAGG + Intronic
989450734 5:41583742-41583764 CAATAGTTACCTGTGGCTAATGG + Intergenic
992873418 5:81028583-81028605 AAACAGGTAGCTGTGAATCAAGG + Intronic
993886438 5:93420872-93420894 AAACATTTACAAGTGGGTCTTGG - Intergenic
995020856 5:107365907-107365929 AAACACTTAACAGTGAGTCAGGG + Intergenic
995172515 5:109133578-109133600 AAACAGTTACCTGTATCTCTGGG + Intronic
995183535 5:109250231-109250253 AAACTTCTCCCTGTGGGTCACGG + Intergenic
996958716 5:129217657-129217679 CTGCAGATACCTGTGGGTCAAGG - Intergenic
999448651 5:151661843-151661865 AAAAAGTTACATGTGGGTAGTGG + Exonic
1001047075 5:168382351-168382373 CAACAGTTACCTCTGGGCAATGG + Intronic
1002560159 5:180075864-180075886 AAATGGTTCCCTATGGGTCAAGG - Intergenic
1004955887 6:20727164-20727186 AAACAGTTACCTGTGGGTCAAGG - Intronic
1006596349 6:35195293-35195315 AAACAGCAAACTGTGGATCAAGG - Intergenic
1007620237 6:43208523-43208545 AAATAGTTACATGTGGCTAATGG + Intronic
1008343298 6:50393636-50393658 AATCAGTTAGCTGGTGGTCAGGG + Intergenic
1011808422 6:91099638-91099660 ACACAGCTGCCTATGGGTCATGG - Intergenic
1015116325 6:129653774-129653796 AAAAAGCTACTTGTGGGTTAGGG + Intronic
1015813839 6:137187226-137187248 TAATAGTGAGCTGTGGGTCATGG + Intergenic
1016389790 6:143563238-143563260 AACCAGTTACGTGTGAGACAGGG + Intronic
1017944532 6:159083557-159083579 AAACAGATACCAGTGGGTAGTGG - Intergenic
1018174490 6:161167131-161167153 AAACAGTTGAATGTGGGTGATGG + Intronic
1019276113 7:176869-176891 AAACAGTTCCCTGAGGTGCAGGG + Intergenic
1019424653 7:968581-968603 CCAAAGTTGCCTGTGGGTCACGG - Exonic
1020279995 7:6645299-6645321 AACCAGACACCTGTGGGGCAGGG - Intronic
1020374954 7:7474486-7474508 AACCAGATACCTGTGTGGCATGG + Intronic
1020379133 7:7523308-7523330 AAAAAGTTAGCTGGGGGTGATGG - Intronic
1021153037 7:17175535-17175557 ATACAGTTACATGTGGGAAAAGG + Intergenic
1023426103 7:40038123-40038145 AAATAGTTACCCATGGGTAAGGG - Intronic
1023599946 7:41872313-41872335 ACACAGTTATATGTGGGTTAGGG - Intergenic
1024163838 7:46709798-46709820 AAAAATTTTCTTGTGGGTCAGGG + Intronic
1024804706 7:53124526-53124548 AAAGAGTTACCTGTGGATAAAGG - Intergenic
1025307244 7:57872320-57872342 AAAGAGTTACCTGTGGATAAAGG - Intergenic
1025481440 7:60988857-60988879 AAAGAGTTACCTGTGGATAAAGG + Intergenic
1027887778 7:83931468-83931490 AGCCAGTTACCTGTGGCTTATGG - Intergenic
1028440649 7:90856277-90856299 AAAGAGTCAACTGTGGGTTATGG - Intronic
1029190526 7:98768663-98768685 AATCAGTTACCTGTGGGGGCTGG + Intergenic
1031079481 7:117244194-117244216 AAACAATTAGCTGTGCGTGATGG + Intergenic
1031253637 7:119419529-119419551 AAACATTTCCTTGTGGATCAGGG - Intergenic
1031253670 7:119420190-119420212 AAACATTTCCTTGTGGATCAGGG - Intergenic
1031433222 7:121699127-121699149 CAGCAGTCATCTGTGGGTCATGG - Intergenic
1032599814 7:133281546-133281568 AAAAAGTTATCTATGAGTCAAGG - Intronic
1033257345 7:139813613-139813635 AAACAGTTACATGTGATTCAGGG - Intronic
1035713514 8:1736935-1736957 AAACAGGTATATGTGGCTCATGG + Intergenic
1035983528 8:4400310-4400332 AAACAGTTTCCTATGGGACCAGG - Intronic
1039187177 8:34930510-34930532 ACCAAGTTACCTATGGGTCAAGG + Intergenic
1040664260 8:49613125-49613147 AAAAAGTTACCTGTGGATCAAGG - Intergenic
1040974480 8:53174865-53174887 ACAAAGTTACCTATGAGTCAAGG - Intergenic
1044287649 8:90427845-90427867 AAAATGCTACCTATGGGTCAGGG - Intergenic
1046534873 8:115496423-115496445 AAACAGTTACCTGTTTGCAAAGG - Intronic
1047722817 8:127657617-127657639 AAACAGGTACCAGTGAGTTAAGG + Intergenic
1049551004 8:143259634-143259656 AAACAGGCACCTGTGGGCAACGG - Intronic
1052323889 9:27196601-27196623 AAACAGTAACCATTGGCTCATGG + Intronic
1053697899 9:40654665-40654687 AAAGAGTTACCTGTGGATAAAGG - Intergenic
1053943907 9:43284860-43284882 AAAGAGTTACCTGTGGATAAAGG - Intergenic
1054309190 9:63454073-63454095 AAAGAGTTACCTGTGGATAAAGG - Intergenic
1054407985 9:64778191-64778213 AAAGAGTTACCTGTGGATAAAGG - Intergenic
1054441131 9:65262021-65262043 AAAGAGTTACCTGTGGATAAAGG - Intergenic
1054489145 9:65759468-65759490 AAAGAGTTACCTGTGGATAAAGG + Intergenic
1054854139 9:69879853-69879875 AAAAAGTTACCTATGGGTTGGGG - Intronic
1055099685 9:72450628-72450650 AGAGAGTTACATTTGGGTCATGG - Intergenic
1055970384 9:81906037-81906059 ACAAAGTTACCGATGGGTCAAGG - Intergenic
1055972575 9:81926475-81926497 ACAAAGTTACCGATGGGTCAAGG - Intergenic
1055974328 9:81941547-81941569 ACAAAGTTACCGATGGGTCAAGG - Intergenic
1055979352 9:81986788-81986810 ACAAAGTTACCTATGGGTCAAGG - Intergenic
1056885676 9:90441561-90441583 AAATAGTTACCTGAGGGTTCAGG + Intergenic
1056900485 9:90594864-90594886 AAACAGTGCCTTGTGGCTCATGG + Intergenic
1057438884 9:95067429-95067451 ACACAGTTCCATGTGGTTCAAGG - Intronic
1058622138 9:106894674-106894696 CAACAGCCACCTGTGGCTCAGGG - Intronic
1202780262 9_KI270717v1_random:27859-27881 AAAGAGTTACCTGTGGATAAAGG - Intergenic
1203582260 Un_KI270746v1:20168-20190 AAAGAGTCACCTGTGGATAAAGG + Intergenic
1203587042 Un_KI270747v1:13437-13459 AAAGAGTTACCTGTGGATAAAGG - Intergenic
1203616286 Un_KI270749v1:69251-69273 AAAGAGTTACCTGTGGATAAAGG + Intergenic
1192783352 X:74315785-74315807 AAAAAGTTACCTATGGGTCCAGG + Intergenic
1195337016 X:103865417-103865439 AGGCACTGACCTGTGGGTCAGGG + Intergenic
1195338465 X:103879911-103879933 AGGCACTGACCTGTGGGTCAGGG + Intergenic
1197367692 X:125584164-125584186 AAAAAGTTTCCATTGGGTCATGG - Intergenic
1198541445 X:137644267-137644289 AAACAGTGACCTGTGTGGCCAGG - Intergenic
1198543030 X:137660816-137660838 AAACAAATACAAGTGGGTCAGGG - Intergenic
1198703299 X:139419921-139419943 AAATAGATCCCTGAGGGTCAGGG - Intergenic
1200523657 Y:4244501-4244523 AAATAGCTACATGTGGCTCATGG - Intergenic
1201195029 Y:11484583-11484605 AAGGAGTTACCTGTGGATAAAGG - Intergenic
1201535323 Y:15041612-15041634 AAACAGGCACCTGTGTGTGATGG + Intergenic