ID: 1004956454

View in Genome Browser
Species Human (GRCh38)
Location 6:20732977-20732999
Sequence CTGCTTTACAAGGGCAACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 148}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004956454_1004956459 -4 Left 1004956454 6:20732977-20732999 CCCTTGTTGCCCTTGTAAAGCAG 0: 1
1: 0
2: 2
3: 17
4: 148
Right 1004956459 6:20732996-20733018 GCAGATGGAAACACAGTAACAGG No data
1004956454_1004956461 8 Left 1004956454 6:20732977-20732999 CCCTTGTTGCCCTTGTAAAGCAG 0: 1
1: 0
2: 2
3: 17
4: 148
Right 1004956461 6:20733008-20733030 ACAGTAACAGGTGGCACTGTAGG 0: 1
1: 0
2: 0
3: 15
4: 135
1004956454_1004956465 17 Left 1004956454 6:20732977-20732999 CCCTTGTTGCCCTTGTAAAGCAG 0: 1
1: 0
2: 2
3: 17
4: 148
Right 1004956465 6:20733017-20733039 GGTGGCACTGTAGGCTGGGGAGG No data
1004956454_1004956462 12 Left 1004956454 6:20732977-20732999 CCCTTGTTGCCCTTGTAAAGCAG 0: 1
1: 0
2: 2
3: 17
4: 148
Right 1004956462 6:20733012-20733034 TAACAGGTGGCACTGTAGGCTGG No data
1004956454_1004956464 14 Left 1004956454 6:20732977-20732999 CCCTTGTTGCCCTTGTAAAGCAG 0: 1
1: 0
2: 2
3: 17
4: 148
Right 1004956464 6:20733014-20733036 ACAGGTGGCACTGTAGGCTGGGG 0: 1
1: 0
2: 0
3: 19
4: 228
1004956454_1004956460 -1 Left 1004956454 6:20732977-20732999 CCCTTGTTGCCCTTGTAAAGCAG 0: 1
1: 0
2: 2
3: 17
4: 148
Right 1004956460 6:20732999-20733021 GATGGAAACACAGTAACAGGTGG No data
1004956454_1004956463 13 Left 1004956454 6:20732977-20732999 CCCTTGTTGCCCTTGTAAAGCAG 0: 1
1: 0
2: 2
3: 17
4: 148
Right 1004956463 6:20733013-20733035 AACAGGTGGCACTGTAGGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004956454 Original CRISPR CTGCTTTACAAGGGCAACAA GGG (reversed) Intronic
901601017 1:10423410-10423432 CTGCTTTACTGGGGACACAAAGG + Intergenic
903512588 1:23887350-23887372 TTGTTTTCCAAGGGAAACAAGGG - Intronic
904271770 1:29354859-29354881 CAGCTTAACAAGGGCAGTAATGG - Intergenic
904323457 1:29711563-29711585 CTGCTTTACAATCTCAAAAAAGG - Intergenic
904899385 1:33844463-33844485 TTGCTTTAGAAAGTCAACAATGG + Intronic
906293281 1:44633574-44633596 GTGCTTTCCAGGGACAACAAGGG + Intronic
907206881 1:52780785-52780807 CAGCTTTTGAAGGGCAAGAAAGG + Intronic
907747080 1:57224010-57224032 GTGTTTTGGAAGGGCAACAAAGG - Intronic
909091951 1:71237059-71237081 CTGTTTTACCAGTTCAACAATGG + Intergenic
909111318 1:71481484-71481506 CCCCTTTAAAACGGCAACAATGG + Intronic
909161554 1:72157529-72157551 CAGCCTTACAAGGGGCACAATGG - Intronic
910081348 1:83346044-83346066 CTACTTTACAGAGTCAACAAGGG + Intergenic
910978543 1:92934848-92934870 CTGCTATACATGGACAACAATGG + Intronic
912709246 1:111937956-111937978 CTTCCTTCCAAAGGCAACAAGGG - Intronic
913205821 1:116537673-116537695 AGGCTTTTAAAGGGCAACAATGG - Intronic
915441989 1:155951132-155951154 CTGCTTTTCAGGGGCCACAGGGG + Exonic
916823751 1:168425293-168425315 CTGCTTAGCAAGGTCACCAAGGG + Intergenic
918534532 1:185559692-185559714 CTCCTTTAAAGGAGCAACAAAGG - Intergenic
921437605 1:215143879-215143901 GTGTTTTCCAAAGGCAACAATGG - Intronic
1064657052 10:17566700-17566722 CATTTTTACAAGGGCAAAAAAGG + Intergenic
1065622508 10:27597954-27597976 CTGCCTTACAAGTGCTAAAAAGG - Intergenic
1065698604 10:28403184-28403206 CTGCTTTAAAAGGGCAATGATGG + Intergenic
1065728357 10:28688579-28688601 CTGCTATACCAGGGCAACTTTGG + Intergenic
1066557372 10:36629035-36629057 CTGCTTTATAAGAGCAGTAATGG - Intergenic
1066960142 10:42215057-42215079 CTGCTTGCCATGGACAACAATGG - Intergenic
1069431837 10:68343493-68343515 CTGCTTTAAAAGGGCAATTTTGG - Intronic
1069588428 10:69626811-69626833 CTGCTTCACAAGGCCAGCCAAGG - Intergenic
1073091971 10:100949315-100949337 CTATTTTACATGGGCAAAAAAGG - Intronic
1073096806 10:100984835-100984857 CTGATTCACAAGGGCCACACAGG - Exonic
1073932831 10:108595970-108595992 CTGCTTCACATGGACAATAATGG + Intergenic
1076355050 10:129846603-129846625 CTGCTTTACAAGGGTCAGAGTGG - Intronic
1077208839 11:1358650-1358672 CTGCTTTTCTAGGTCAACACTGG + Intergenic
1078042352 11:7879508-7879530 CCTCTTTACAAGGAAAACAAAGG + Intergenic
1081562556 11:44231113-44231135 ATGCTTTGGAAGGGCAAGAATGG + Intronic
1083753982 11:64779130-64779152 CTGCGTTACCATGGGAACAAAGG - Intergenic
1087963121 11:104376823-104376845 CTGCTGTAGAAAGGCAACACCGG - Intergenic
1088963590 11:114695526-114695548 CTCCTTAACAAGGAGAACAAGGG - Intronic
1089167039 11:116485339-116485361 CTGCTTCAGAAAGGCAACATGGG + Intergenic
1090040506 11:123286679-123286701 CTGCTTTAAATGGGCTACCACGG + Intergenic
1093200027 12:16175484-16175506 CAGCTTCTCAAAGGCAACAACGG + Intergenic
1093323497 12:17743332-17743354 GTTCCTTACAAGGGCACCAAGGG - Intergenic
1093352678 12:18123086-18123108 GTGCTTTAACAGGGCAGCAATGG - Intronic
1095184208 12:39182503-39182525 CTGCTTTGCATTGACAACAATGG - Intergenic
1095365867 12:41404397-41404419 CTCCTTTACAATAGCCACAAAGG + Intronic
1096421276 12:51460036-51460058 CAGCCTCACAAAGGCAACAATGG - Exonic
1096486402 12:51984720-51984742 CTGGTTGACCAGGGCCACAATGG + Intronic
1096774421 12:53955449-53955471 CTGCTCAACGAGGGCAACAAGGG + Exonic
1097311155 12:58120945-58120967 CTGCATTCCAAGGGAAACGAAGG - Intergenic
1098078175 12:66755937-66755959 CTGCTTCTCAAGACCAACAAGGG - Intronic
1098384790 12:69907421-69907443 CTGCTTTTCATCTGCAACAAAGG + Intronic
1103027331 12:117584055-117584077 CAGCTTTACAAGGGCAGAATTGG - Intronic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1108262583 13:48673789-48673811 CTGCCTTACAAGAGCTCCAAAGG - Intronic
1108419400 13:50233499-50233521 CTGTTTTAAAAGGGAAACAGAGG + Intronic
1108758681 13:53535357-53535379 GTGCTTGACAAAGGGAACAATGG - Intergenic
1110246334 13:73328479-73328501 CTGCTTTACAAAAGAAAAAAAGG + Intergenic
1110410047 13:75194933-75194955 CTGGTTGGCAAGGGCAACAGAGG - Intergenic
1112615673 13:101002711-101002733 CTGCTTTACAAATGCCACCAGGG - Intergenic
1113120605 13:106919994-106920016 GTTCTTTTCAAGGGCGACAATGG + Intergenic
1113968107 13:114166231-114166253 CTGCATTAAGATGGCAACAAGGG + Intergenic
1116448167 14:45036222-45036244 TTGCTTTACCAAGGCAACAAAGG + Intronic
1117289616 14:54319995-54320017 CTGCATTAAAATAGCAACAAAGG + Intergenic
1119982462 14:79097391-79097413 CTGCTTTCCAAGGGTAAGCATGG + Intronic
1120548977 14:85846037-85846059 TAGCATTACAAGGGCAAGAAGGG + Intergenic
1126279261 15:46923882-46923904 CTCTTTTAAAAGGACAACAAAGG + Intergenic
1126583620 15:50262644-50262666 CTGCTTTTCAAGAGCAAGAAGGG - Intronic
1128097481 15:64968764-64968786 GTGCTTCACAAGGGTAACAAGGG - Intronic
1138915620 16:61460585-61460607 CTGCTTTAAAAAGAAAACAATGG + Intergenic
1141839272 16:86564203-86564225 CTGACTTACAAGGTCAAGAAGGG + Intergenic
1142675260 17:1509343-1509365 CTGTTCTACCAGGGGAACAAAGG - Exonic
1144077444 17:11732113-11732135 CTACTATCCAGGGGCAACAATGG - Intronic
1146547059 17:33748934-33748956 CTTCTTTTCAAGGGGAACACAGG + Intronic
1152044815 17:77928977-77928999 CTGCTGTCGAAGGGCCACAAGGG + Intergenic
1153704360 18:7730094-7730116 CAGTTTTACAAGGGCCAAAATGG + Intronic
1155845608 18:30702285-30702307 CTTCTTTACAAGGGAAATGAGGG - Intergenic
1156238824 18:35231136-35231158 CTGCTTTAAATGGCCAACAGGGG + Intergenic
1158233314 18:55284001-55284023 TTGCTTTTAAAGGGCAAAAAAGG + Intronic
1159825073 18:73197858-73197880 CTGATTTTCAATGGCAACAGTGG - Intronic
1160742652 19:694670-694692 CTGGATTTAAAGGGCAACAAAGG - Intronic
1162146567 19:8615926-8615948 CTACTTTCCAAGGGCAACAATGG - Intergenic
1164485680 19:28653831-28653853 CTGGTTTATAAAGGAAACAAAGG + Intergenic
927739436 2:25554409-25554431 CTGCTTTACAAGAGAATTAAAGG + Intronic
930094830 2:47559096-47559118 CTGCTTTCTGAGGGTAACAAGGG + Intronic
931629355 2:64285212-64285234 CTCCTGTACAAGGGCCACCAAGG - Intergenic
931706575 2:64951437-64951459 CTGGTTTTCAAGGCCAACAAGGG + Intergenic
932452121 2:71817832-71817854 CTCCTTAACAAGGTCAAAAAAGG + Intergenic
938025179 2:127941517-127941539 CTGCTGTAAAAGGCCAACATGGG + Exonic
938416527 2:131107489-131107511 CTGTTCTTCAAGGGCAACAGTGG - Intronic
939862526 2:147436806-147436828 CTACTTTCCAAGGGGAAAAATGG + Intergenic
940665694 2:156606408-156606430 CTGCTATACAAGTTTAACAAAGG - Intronic
946298815 2:218809577-218809599 GTGCTTTACAAGGCCAAGTACGG + Exonic
946588042 2:221212550-221212572 CTTCTTTACAAGGCCAATATCGG - Intergenic
948352609 2:237353393-237353415 CTTATTTCAAAGGGCAACAAGGG - Exonic
1169539813 20:6587250-6587272 GTGATTTACACAGGCAACAAAGG - Intergenic
1169954400 20:11085003-11085025 CTGGTTTATAATGGCACCAAAGG + Intergenic
1172716709 20:36969640-36969662 CTGCTACACAAATGCAACAAAGG + Intergenic
1178735688 21:35147907-35147929 CTGCTTTAAAAGACCATCAACGG - Intronic
1178969553 21:37160084-37160106 CTGCTCTAGAAGGAAAACAAAGG + Intronic
1180652196 22:17387266-17387288 TTGCTTGACAAGGGCAAGGAGGG - Intronic
1180922374 22:19527539-19527561 CTGCTTTCCCAGGGGAAGAATGG + Exonic
949139787 3:618107-618129 AGGGTTTTCAAGGGCAACAATGG + Intergenic
949856608 3:8467478-8467500 GTGCTTTAAAGGGGCAACCAAGG - Intergenic
951192388 3:19785948-19785970 CTGTTTTAAAAGGGAAACAAAGG + Intergenic
951711135 3:25585718-25585740 CTCTTTTACAAGGGCAACCCCGG - Intronic
952779445 3:37080980-37081002 ATGCTTTAAAAGAGAAACAATGG + Intronic
954498256 3:50985312-50985334 CTGCTTTAAAAGGACAACTGAGG - Intronic
956127129 3:66021325-66021347 CTGCCTTAAAAGGGCAAGCATGG + Intronic
962499549 3:135976152-135976174 GTGTTCTACATGGGCAACAATGG - Intronic
962969707 3:140387615-140387637 CTGCTTGACAAGGGCCACTTCGG - Intronic
964770659 3:160221528-160221550 CTCCTTAAAAAGGACAACAAGGG - Intergenic
970951207 4:21757682-21757704 CTACTTTACAAGGGCAAAAAAGG - Intronic
971021529 4:22541386-22541408 CTGCTTTTCAAGGATAACAATGG - Intergenic
971287982 4:25308550-25308572 CTTCTTCACCAGGGCAACCAAGG - Intergenic
973004807 4:44993486-44993508 CTGCTTCACAAGGACAGAAAAGG + Intergenic
974478887 4:62419682-62419704 CTACTTAAGAAGTGCAACAATGG - Intergenic
976072034 4:81252643-81252665 CTGCATTAAAAGGGAAACCAAGG - Intergenic
976378882 4:84376924-84376946 GTGCTTTACATGGAAAACAAAGG + Intergenic
981748008 4:148069331-148069353 CTGCTTTACAGAGGCGACCAAGG - Intronic
984681871 4:182620405-182620427 CCTCTTTCCAAAGGCAACAATGG - Intronic
986840129 5:11687281-11687303 CTGCATTGCAAAGGCAACAAGGG + Intronic
991222149 5:64228757-64228779 TGGCTTTACAAGGAGAACAAAGG - Intronic
993560593 5:89402582-89402604 CTGCAGAACAGGGGCAACAAAGG + Intergenic
996913458 5:128681915-128681937 CTGCTCTATAAGGTCATCAAGGG - Intronic
998508155 5:142688884-142688906 GAGCTTTAGAAGGGCAACAAAGG + Intronic
998555206 5:143116593-143116615 CTGCCTTACAAGCCCTACAAGGG + Intronic
999549610 5:152671883-152671905 CTTATTTTCAAGGGCAACAAGGG - Intergenic
1003950225 6:11109540-11109562 CTGTTTTACAAGCCCAACAAAGG + Intronic
1004863509 6:19831669-19831691 CTTCTATCCAAGGGCCACAATGG - Intergenic
1004956454 6:20732977-20732999 CTGCTTTACAAGGGCAACAAGGG - Intronic
1005581678 6:27241159-27241181 CTGATTTCCAAAGGCAATAACGG - Intergenic
1014553035 6:122810730-122810752 CTGCTTGACTAGGCCAACATTGG - Intergenic
1018303952 6:162434390-162434412 GTGCTTTACAAAGGCTACTATGG + Intronic
1019007839 6:168817229-168817251 CTGGTTTGCAAGGGCAAAGAAGG - Intergenic
1022873561 7:34504610-34504632 GTGCATTCCAAGGGCTACAAAGG + Intergenic
1022947677 7:35303650-35303672 CTTCTTTACAATGGCAAAGATGG + Intergenic
1024835649 7:53514858-53514880 CTGATATACAAGGTCAAGAAAGG - Intergenic
1033538960 7:142338560-142338582 CTGCTCTCTAAGTGCAACAACGG + Intergenic
1034334383 7:150311100-150311122 CTGCTTTACAAGCTCACTAAAGG + Intronic
1034704298 7:153126976-153126998 CTGATTAAAAAGGGCAGCAATGG + Intergenic
1037601197 8:20395511-20395533 CTCCTTTTGAAGGGCACCAAGGG + Intergenic
1038497277 8:28012537-28012559 CTGCTTTAAAAGTGCAACCGAGG + Intergenic
1044639219 8:94360766-94360788 CTGATTTCCAAGGCCAACCATGG + Intergenic
1045187874 8:99857070-99857092 TTGCTTTTGAAGGGCAATAAAGG + Intronic
1045740705 8:105356252-105356274 CTGCTTTAGAAGGCCAAGACAGG + Intronic
1046082484 8:109388256-109388278 CAGCTCCCCAAGGGCAACAAAGG + Intronic
1046133432 8:109996484-109996506 CTGCTTTGCAGGGGCAACTAAGG - Intergenic
1046201926 8:110938326-110938348 ATGATTTAAAAGGGCAACAACGG + Intergenic
1047548138 8:125839547-125839569 CTGCAGTGCAAGGGCAGCAAGGG - Intergenic
1048192495 8:132302527-132302549 CTTATTTCCAAGGGCAACACAGG + Intronic
1050245936 9:3689690-3689712 CTGCTTGACAAGAGTAGCAAAGG - Intergenic
1051588756 9:18754419-18754441 CTGCTTTAAAGGGACAACAAAGG + Intronic
1052486523 9:29107966-29107988 CTGCTTTAAAAGGAAAACATAGG + Intergenic
1057672665 9:97107795-97107817 CTCCTTTCCATGGGCACCAAAGG + Intergenic
1057988320 9:99740834-99740856 CTGCTTCACAAGGTCAAGGATGG - Intergenic
1058181650 9:101807358-101807380 CTGTTTTAAAAGGGAAACAGAGG + Intergenic
1058299373 9:103351649-103351671 ATGCTTTAAAAGTGCAACATTGG + Intergenic
1059555597 9:115277093-115277115 CTGCTGTGACAGGGCAACAATGG + Intronic
1059943524 9:119381995-119382017 CTGCTTTACAACTGAAACACTGG + Intergenic
1186787773 X:12969514-12969536 CTGCTTCACAATGGAATCAAAGG + Intergenic
1188627584 X:32305726-32305748 CTTCTTTACAATGGCCCCAAAGG + Intronic
1189429277 X:40932699-40932721 CTGTTTTTCAAGGGCTCCAAAGG - Intergenic
1190536627 X:51434856-51434878 TTGTTTTAAAAGGGCAACACAGG - Intergenic
1190746182 X:53323127-53323149 CTGGTTTTCAATGGCAACAATGG - Intergenic
1191607507 X:63078648-63078670 CTGCTGCACAAATGCAACAAAGG - Intergenic
1192119490 X:68441633-68441655 AGGCTTTATAAGGGCAATAAAGG + Intergenic
1196942491 X:120791140-120791162 CTGCTTATAAAGGGCAACACAGG - Intergenic
1196979026 X:121191327-121191349 CTGCTTTACAGGGACAATATTGG - Intergenic
1199019136 X:142854964-142854986 CTTCTTTAAAAAGTCAACAAGGG + Intergenic