ID: 1004961422

View in Genome Browser
Species Human (GRCh38)
Location 6:20793458-20793480
Sequence TTAGGCATCATGGAAACAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004961422_1004961425 -6 Left 1004961422 6:20793458-20793480 CCTGTTGTTTCCATGATGCCTAA 0: 1
1: 0
2: 1
3: 19
4: 155
Right 1004961425 6:20793475-20793497 GCCTAATAATGGCAACGTGATGG No data
1004961422_1004961427 -2 Left 1004961422 6:20793458-20793480 CCTGTTGTTTCCATGATGCCTAA 0: 1
1: 0
2: 1
3: 19
4: 155
Right 1004961427 6:20793479-20793501 AATAATGGCAACGTGATGGTTGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004961422 Original CRISPR TTAGGCATCATGGAAACAAC AGG (reversed) Intronic
903127389 1:21257326-21257348 TCAGGCATCATGGACACAAGGGG - Intronic
904640032 1:31919411-31919433 TTAAGCATCAAGTAAACAAGTGG - Exonic
908328115 1:63043794-63043816 TTACGAATCATGGTAACATCAGG + Intergenic
915150626 1:153828078-153828100 TCAGGCCTCATGGAGACAACAGG - Exonic
916866676 1:168867243-168867265 TTTGGCATCATGGAAAACATAGG + Intergenic
920843269 1:209572867-209572889 TTATTCAACATGAAAACAACTGG - Intergenic
921300050 1:213743580-213743602 CTAGGCTTCAAGGAAACAAATGG - Intergenic
921594555 1:217039947-217039969 TTAGGCTCCATGGAAACATATGG + Intronic
922094003 1:222425478-222425500 TTTGGGGTCATGGATACAACCGG - Intergenic
924699314 1:246435008-246435030 TGCGGCAACATGGAAACAGCTGG + Intronic
1066535839 10:36390402-36390424 TTTGGCTTCATGGAAACCCCTGG - Intergenic
1067257348 10:44655355-44655377 TTAGGAAACAGGGAAACTACAGG - Intergenic
1067919974 10:50445122-50445144 TTAGTCACCAAGGAAACAACAGG + Intronic
1068458483 10:57292905-57292927 ATAGGCATCAAGTAGACAACAGG - Intergenic
1069456286 10:68556585-68556607 TTAGACTTTATGGAAACATCTGG + Intergenic
1070016319 10:72535901-72535923 TGAGGCAACATGGATGCAACTGG + Intronic
1070492993 10:76994895-76994917 CAAGGCATGATGGAAACCACAGG + Intronic
1072176938 10:92935292-92935314 TTTGGTATCATGGAATTAACAGG - Intronic
1074541981 10:114372507-114372529 TTTGGCATCATGGAAGCTTCCGG - Intronic
1075864739 10:125707830-125707852 TTAGGCAGAATGGTAACTACTGG - Intergenic
1076599267 10:131646574-131646596 TCAGGCATCCTGGAATCACCTGG + Intergenic
1077534027 11:3110540-3110562 CCAGGCACCATTGAAACAACAGG - Intronic
1083772084 11:64873492-64873514 TGGGGCATGCTGGAAACAACAGG - Intronic
1084978727 11:72817133-72817155 TTAGGCATCAGGCAAGGAACAGG - Intronic
1087538940 11:99490666-99490688 TAAGGCATCATGCAATCAGCAGG - Intronic
1087734195 11:101813470-101813492 TTCAGCAACATGGATACAACCGG + Intronic
1089437177 11:118479376-118479398 TTAAGCATCTTGTAAACTACTGG + Intronic
1090609402 11:128456740-128456762 TACGGCATCATGGAAAGAACAGG + Intergenic
1091248848 11:134124659-134124681 TTAGGCATCAAGGAAACAAGTGG - Intronic
1092254088 12:6916823-6916845 TTAGGAATCATGGTTACAAGGGG + Intronic
1095122991 12:38441421-38441443 TTAGGCATCTGGGGAACAAATGG + Intergenic
1095612117 12:44141650-44141672 TTAGGTATCATTGAAAGAACTGG + Intronic
1097968800 12:65610192-65610214 TTGGGCCTCAGGGAATCAACGGG + Intergenic
1101180350 12:102210176-102210198 TTTAGCAACATGGAAACAGCTGG + Intergenic
1111737578 13:92162115-92162137 TTAGACTTCAGGGAAAAAACAGG - Intronic
1111978329 13:94990985-94991007 GTCGGCAGCATGGAAACCACAGG - Intergenic
1112836930 13:103527149-103527171 TTAAGCAAAATGAAAACAACAGG - Intergenic
1113101876 13:106729156-106729178 TTAGGCATGATGGATTCACCCGG + Intergenic
1114816006 14:25958824-25958846 ACAGGCCTAATGGAAACAACCGG - Intergenic
1117613566 14:57508905-57508927 GGAGGCATTATGGAGACAACTGG - Intergenic
1118771673 14:68946575-68946597 TTAGGCAGCATGGACCCAGCGGG - Intronic
1118816536 14:69318130-69318152 ACAGGTGTCATGGAAACAACAGG - Intronic
1119984714 14:79124267-79124289 TCAGGCATCATCAAAACAAAAGG + Intronic
1120571960 14:86129725-86129747 TTAGGCATAAAGGAAAAAAAGGG - Intergenic
1125040493 15:35180449-35180471 TTAGGCATTGTGGAACCCACTGG - Intergenic
1125889552 15:43255448-43255470 TTGGGCATCATGGAGAGACCTGG - Intronic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1129749978 15:78055852-78055874 TAATGCAACATGGAAACTACTGG - Intronic
1131800633 15:96065877-96065899 TTAGGCAACCTGGAAAAGACAGG + Intergenic
1132222847 15:100117772-100117794 CTTGGCATCATGGAAACGAATGG - Intronic
1134139835 16:11708577-11708599 TAAGGCATCATGGAACAAAATGG + Intronic
1139015250 16:62682407-62682429 TTAGGTGTCAGGGTAACAACAGG + Intergenic
1141353356 16:83319942-83319964 TTAGGCATCATGGAAAAACGAGG + Intronic
1142892349 17:2952197-2952219 TTATGTTTCATGGAAACAATGGG + Intronic
1147461439 17:40573084-40573106 TTAGAAATAATGGAAACAAATGG + Intergenic
1147719965 17:42533170-42533192 TTAAGCATCAAGTAAACAAGTGG + Intergenic
1149541268 17:57469946-57469968 TGAGGCATCATGGCATCATCAGG - Intronic
1151228842 17:72667288-72667310 TTAGGCTTCAGGGTAACAGCAGG - Intronic
1152908162 17:82981445-82981467 TCAGCCAGCCTGGAAACAACAGG - Intronic
1153520957 18:5953406-5953428 ATAGGCATCAGGAAAACAACAGG - Intergenic
1155520704 18:26665848-26665870 TTAGGCTAAATGGACACAACAGG - Intergenic
1156770704 18:40719344-40719366 TGAGGCAATATGTAAACAACTGG - Intergenic
1157243756 18:46035505-46035527 TTAGGCATCAGGGAAAAAGGAGG + Intronic
1158043852 18:53131442-53131464 TTAAGCATATTGGAAACAAGAGG + Intronic
1164773409 19:30831115-30831137 TCAGGCATCAAGGAGACAAGTGG - Intergenic
926897675 2:17712167-17712189 TTCGGCAACAAGGAAATAACTGG + Intronic
928696946 2:33858890-33858912 CTAGGCATCATGGAACAAGCTGG + Intergenic
932113725 2:69025425-69025447 TTAAGCATCAGGGGAAAAACAGG - Intronic
932911176 2:75807649-75807671 TTAGGCACTGTGGATACAACTGG + Intergenic
933692074 2:85186468-85186490 ATGCTCATCATGGAAACAACAGG - Intronic
939026470 2:137020009-137020031 TTAGGGATCATGAAAACGCCAGG + Intronic
939099429 2:137879252-137879274 TTTGTGATCATGGAAACAAGTGG + Intergenic
940518293 2:154709798-154709820 GAAGGCATTGTGGAAACAACTGG + Exonic
941780560 2:169440112-169440134 GTAGGCAAAATGGAGACAACTGG + Intergenic
943287946 2:186028821-186028843 TTATGCATCATGCAAAGAAAAGG - Intergenic
943785998 2:191879859-191879881 TTAGGCAGCAAAGAAAGAACAGG - Intergenic
944385619 2:199160810-199160832 TTAGTCATCAGTGAATCAACTGG + Intergenic
946985880 2:225272365-225272387 TCAGGCACCAGGGAAAGAACAGG - Intergenic
947806863 2:232975159-232975181 TTAGGAATAATGTAAACAAACGG - Intronic
1169256266 20:4102216-4102238 TAAGACATTTTGGAAACAACTGG + Intergenic
1169894204 20:10485110-10485132 TTAGGCATTAGGGAATCAATGGG + Intronic
1170334384 20:15252078-15252100 TTAGGCAGCATGTGAACAAAGGG + Intronic
1173712384 20:45171196-45171218 TGAGGCTTGATGGAAACAGCAGG + Intergenic
1177783324 21:25642786-25642808 TAAGGCACCATAGAATCAACAGG - Intronic
1178796706 21:35751834-35751856 TAAGGCATCATGTGAACAACCGG + Intronic
1179181395 21:39048174-39048196 ATAGGCTACAGGGAAACAACTGG - Intergenic
1182340463 22:29616351-29616373 TTAGGCAAAATGTAAACAATGGG + Intronic
1183147843 22:36011045-36011067 CTAGGCATCTGGGAAACATCTGG + Intronic
1183830395 22:40415797-40415819 GTAGGCATCATGGGCACAACAGG - Intronic
950432031 3:12956319-12956341 TTAGGTTTCTTGGGAACAACTGG - Intronic
950627420 3:14258352-14258374 TTCTGCCTCATCGAAACAACTGG + Intergenic
951245111 3:20331766-20331788 TTAGGCACCAGGGACACAACAGG - Intergenic
952224356 3:31359264-31359286 TGAGGCATCTTAAAAACAACAGG - Intergenic
954521412 3:51230022-51230044 TGAGACAACATGGATACAACTGG - Intronic
957476540 3:80732818-80732840 TTAGGCTTCATGAAAACCACAGG - Intergenic
957724397 3:84045809-84045831 TTTGGCATCATGGCAGAAACAGG + Intergenic
957744770 3:84325261-84325283 TTAGGCATCAGAGAAGCAAGTGG + Intergenic
957754963 3:84473034-84473056 TTTGGTATCAGGGAAATAACTGG - Intergenic
964606769 3:158568784-158568806 TTAGGCATCATTGAACAAAACGG - Intergenic
966880865 3:184350177-184350199 TTAGACATCATGGAACCCATTGG + Intronic
968249580 3:197195573-197195595 TGTGGCAACATGGATACAACTGG + Intronic
968439428 4:614844-614866 TTAGACATGATGGAAACAAATGG - Intergenic
971064979 4:23021390-23021412 GAAGGTTTCATGGAAACAACTGG - Intergenic
971871835 4:32250993-32251015 GTAGGCAACAGGGAAATAACTGG - Intergenic
976422067 4:84856821-84856843 TTAGCAATCATGGTAAGAACTGG + Intronic
977024525 4:91799173-91799195 TAATGCATCCTGGAAACAAAAGG - Intergenic
978458732 4:108926270-108926292 TTAGTCATCAGGGACAGAACAGG - Intronic
979515075 4:121598380-121598402 TTAGGCATTATGGAAAGTACTGG - Intergenic
980503512 4:133685834-133685856 TTAAGCAGCCAGGAAACAACAGG - Intergenic
981295975 4:143131869-143131891 TTGGGAATAATAGAAACAACAGG + Intergenic
982410644 4:155072540-155072562 ACAGGCATCATGCAATCAACTGG - Intergenic
982996485 4:162354548-162354570 TTAGGCAGCATTGAATCTACTGG - Intergenic
983260063 4:165446365-165446387 TTAAGAAACATAGAAACAACAGG + Intronic
984305100 4:177979414-177979436 TGAGGGAACATGGAAAGAACTGG + Intronic
986607911 5:9540696-9540718 TTGGGCATCCTGTAAACAAATGG - Intronic
989135026 5:38145005-38145027 GTAGGCATGATGGAAAGAAGGGG + Intergenic
989685266 5:44078221-44078243 TTTCGAATCATTGAAACAACTGG + Intergenic
990215374 5:53525957-53525979 TGTGGCAACATGGATACAACTGG - Intergenic
991632524 5:68670692-68670714 ATGGGTGTCATGGAAACAACAGG + Intergenic
993483355 5:88451698-88451720 CTGGGCAACATGGAAACACCTGG + Intergenic
994668779 5:102740986-102741008 TAAGGCATCATAGAAACCATGGG + Intergenic
1000827884 5:166069139-166069161 TTGGGCAATATGGAAACCACAGG - Intergenic
1001754883 5:174160579-174160601 ATAGACAACATGGAAACAAGTGG - Intronic
1002590565 5:180289145-180289167 TTATGCCTCATGAAAACAACTGG + Intronic
1003443805 6:6166797-6166819 AGAGGCATCATGAAAACTACTGG + Intronic
1003535019 6:6969161-6969183 TTATGCATCATAGTGACAACTGG - Intergenic
1004961422 6:20793458-20793480 TTAGGCATCATGGAAACAACAGG - Intronic
1005531052 6:26706194-26706216 TTCGGCATTATGAAAAAAACAGG + Intergenic
1005539744 6:26795442-26795464 TTCGGCATTATGAAAAAAACAGG - Intergenic
1007942147 6:45791483-45791505 TTAAGCAGCCTGGAAAAAACAGG - Intergenic
1008247722 6:49199399-49199421 TTAGGCATCATGTAAGCCAGTGG - Intergenic
1013236769 6:108203657-108203679 TTAGTGAACATGAAAACAACTGG + Intergenic
1013339924 6:109203936-109203958 CTAGGCAACCTGGCAACAACAGG + Intergenic
1016542993 6:145187739-145187761 TGAGGCATCATGGAAGCCCCAGG - Intergenic
1017115197 6:150969309-150969331 TTAGGCAGCAAAGAAATAACAGG - Intronic
1019608702 7:1924043-1924065 TTAAGCAGCATGAAAAGAACCGG + Intronic
1021298744 7:18943505-18943527 TTAAGCATCATGGAAATTATGGG + Intronic
1022803571 7:33799191-33799213 TACGGCATCATGGAAGTAACAGG - Intergenic
1023472194 7:40535707-40535729 TGAAGCAACATGGATACAACAGG + Intronic
1029716692 7:102332127-102332149 TTAGGCAGGATGCAAACATCAGG + Intergenic
1031050371 7:116938752-116938774 TTGGACATTTTGGAAACAACTGG - Intergenic
1031288331 7:119900652-119900674 TTGGGCATTAAGGAAACATCAGG - Intergenic
1031588061 7:123556669-123556691 TTTGGCAACATGGAGATAACTGG + Intronic
1034583809 7:152070906-152070928 TTGGGCATCACGGAACCTACCGG - Intronic
1035231180 7:157466956-157466978 TTCCGCATCAAGGAAACAAGCGG + Intergenic
1036392159 8:8332923-8332945 TTAGGCAAGCTGGAAATAACAGG + Intronic
1037459288 8:19093326-19093348 CCTGGCATCATGGAAACAGCTGG - Intergenic
1038300011 8:26335773-26335795 TGAGGAATCCTAGAAACAACTGG - Intronic
1038567691 8:28633723-28633745 TTAGACAGCATGTAAACAAAAGG - Intronic
1039021839 8:33216558-33216580 GTAGGTATCATGGAATCAAATGG + Intergenic
1043372350 8:79610294-79610316 TTGGGCATTAAGGAAACCACAGG - Intergenic
1043376088 8:79651445-79651467 TTATTCATAATGGAAACCACAGG + Intronic
1044216278 8:89614627-89614649 TTAGGCAAAAAAGAAACAACTGG - Intergenic
1045588902 8:103570628-103570650 TCAGGGATCATGCTAACAACCGG - Intronic
1046201848 8:110937424-110937446 TTAAGCAACATGGACACAACTGG + Intergenic
1046786944 8:118277629-118277651 TTAGGAATCAGGGAAACAAAAGG + Intronic
1050114919 9:2253809-2253831 AAAGGCTTCCTGGAAACAACTGG + Intergenic
1050731495 9:8714463-8714485 TCAGGCTTCCTGGAAGCAACAGG - Intronic
1052291342 9:26845200-26845222 TTAAGCACCAAGGAAACAGCAGG - Intronic
1055000232 9:71440697-71440719 TTAGGCACCATGGTAAGTACTGG - Intronic
1057214462 9:93220323-93220345 TTGGGCAGCATGGACAGAACAGG - Intronic
1057763229 9:97892891-97892913 TTAGCCATCATGGAAACATGGGG - Intergenic
1058094229 9:100840612-100840634 TTATGTGACATGGAAACAACAGG - Intergenic
1059221737 9:112627929-112627951 TGAGGCAAGATGGAAACACCAGG - Intronic
1061653964 9:132073559-132073581 TTTTGCATCATGGAACTAACAGG - Intronic
1186124186 X:6395036-6395058 TTGGGCATCAAGGAGAGAACAGG + Intergenic
1186223366 X:7373025-7373047 TGAGACATCATGGAAACGTCAGG - Intergenic
1188926770 X:36053336-36053358 TTTAGCATCATGGCAACAAAAGG + Intronic
1189245774 X:39562115-39562137 TTTGGCATCCTGGAAAAATCTGG - Intergenic
1191101135 X:56729669-56729691 TTTGAAATCATGGAAAGAACAGG - Intergenic
1192804321 X:74495988-74496010 TGAGAGATCATGGAACCAACTGG + Intronic
1197390124 X:125852973-125852995 TTATCAAGCATGGAAACAACTGG - Intergenic
1197605709 X:128582583-128582605 TTGGGGATCATGGACACAAAGGG - Intergenic
1199351943 X:146811807-146811829 TTAGGCATCATCCAAACAAGTGG - Intergenic
1199351964 X:146812686-146812708 TTAGGCATCATCCAAACAAGTGG + Intergenic
1200847638 Y:7848598-7848620 TTAGTCCTGATGGAAATAACTGG - Intergenic