ID: 1004963208

View in Genome Browser
Species Human (GRCh38)
Location 6:20816132-20816154
Sequence CTGTTGTCCTTAAAAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 990
Summary {0: 1, 1: 1, 2: 14, 3: 126, 4: 848}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004963208_1004963211 -9 Left 1004963208 6:20816132-20816154 CCTTTTTTTTTTAAGGACAACAG 0: 1
1: 1
2: 14
3: 126
4: 848
Right 1004963211 6:20816146-20816168 GGACAACAGTCATTGGATTAGGG 0: 4
1: 48
2: 197
3: 467
4: 794
1004963208_1004963210 -10 Left 1004963208 6:20816132-20816154 CCTTTTTTTTTTAAGGACAACAG 0: 1
1: 1
2: 14
3: 126
4: 848
Right 1004963210 6:20816145-20816167 AGGACAACAGTCATTGGATTAGG 0: 5
1: 41
2: 147
3: 270
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004963208 Original CRISPR CTGTTGTCCTTAAAAAAAAA AGG (reversed) Intronic
900293454 1:1935849-1935871 GTGTAGTGCTGAAAAAAAAAAGG - Intronic
900763329 1:4487443-4487465 CTTGTGTCCTTACAAAAACAGGG - Intergenic
900775828 1:4584884-4584906 CTGTTTTCCTTCAAAACAAGAGG - Intergenic
900894777 1:5475457-5475479 CTGGTGTCCTTATAAGAAGAGGG + Intergenic
901126506 1:6932815-6932837 CTTTTGTCCTTTAAAAAAGTCGG + Intronic
901174596 1:7289687-7289709 CTGGTGTCCTTAGAAGAACAGGG + Intronic
901410700 1:9081759-9081781 CTATCATACTTAAAAAAAAAGGG + Intronic
902041941 1:13499027-13499049 CTGGTGTCCTTATAAAAAGGGGG - Intronic
902087717 1:13875995-13876017 CTGATGTCCTTATTTAAAAAGGG - Intergenic
902126129 1:14213197-14213219 CTGATGTTCTCAAAAGAAAAAGG - Intergenic
903502601 1:23809703-23809725 CTGGTGAACTTAAAAAAAGATGG + Intronic
903503379 1:23814901-23814923 CTGGTGACCTTAAAAAAAGATGG + Intronic
904117453 1:28173279-28173301 CTGTGTCTCTTAAAAAAAAAGGG + Intronic
904970963 1:34419104-34419126 CTGGTGTCCTTATAAGAAGAGGG + Intergenic
905817381 1:40962332-40962354 TTCTTGTCCTTAATAAAATAAGG - Intergenic
907032689 1:51187818-51187840 ATCTTGTCTTTAAAAAGAAAGGG + Intergenic
907567251 1:55446924-55446946 CTGTCTTCATTAAAAATAAAAGG + Intergenic
907853887 1:58282596-58282618 CCTTTGTTCTAAAAAAAAAAAGG + Intronic
907872037 1:58452239-58452261 TTTTTGCCCTTTAAAAAAAAAGG - Intronic
908435703 1:64103784-64103806 CACTTCACCTTAAAAAAAAAAGG + Intronic
908572289 1:65422216-65422238 CTGGTGTCCTTATAAGAAGAGGG + Intronic
908825825 1:68131826-68131848 CTGGTGTCCTTTGAAAGAAAAGG + Intronic
908874055 1:68649337-68649359 ATCTTCTCCTTTAAAAAAAATGG + Intergenic
909440977 1:75695962-75695984 GTGCTGCCATTAAAAAAAAAAGG - Intergenic
909512613 1:76471865-76471887 CTGTTGTTAAAAAAAAAAAAGGG - Intronic
909535423 1:76730610-76730632 TTATAGTCCGTAAAAAAAAAAGG + Intergenic
909869981 1:80727148-80727170 TTGATATCTTTAAAAAAAAAAGG - Intergenic
909954756 1:81765787-81765809 CTTTTGTCCTTAATGAAATAAGG - Intronic
909967741 1:81937753-81937775 CTTTCCTCCTTTAAAAAAAAAGG + Intronic
910065563 1:83146791-83146813 CTGGTGTCCTTATAAGAAGAAGG + Intergenic
910198315 1:84669170-84669192 CTTTTCTCTTAAAAAAAAAAAGG - Intronic
910425121 1:87113947-87113969 CTCTTTCTCTTAAAAAAAAAGGG - Intronic
910533572 1:88269866-88269888 CTGGTGTTCTTTTAAAAAAATGG + Intergenic
910552342 1:88489884-88489906 CTGATGTCCTTGTAAAAGAAGGG + Intergenic
910664339 1:89708187-89708209 GAGTTGTCCTTGAAAGAAAATGG + Intronic
911181406 1:94863690-94863712 CAGTTGTCCCACAAAAAAAAAGG - Intronic
911484253 1:98485841-98485863 CTTCTGTATTTAAAAAAAAAAGG + Intergenic
911568957 1:99498941-99498963 CTGTGGTCTTTAAAAAAAGGGGG + Intergenic
911944346 1:104087180-104087202 CTGGTGTCCTTATAAGAAGAGGG - Intergenic
912178480 1:107189451-107189473 CAGTGGTCTTGAAAAAAAAAAGG + Intronic
913142703 1:115956988-115957010 CTGTTCCCCATAAAAAAAAAAGG - Intergenic
913282164 1:117196593-117196615 CTGTACTCTTAAAAAAAAAAAGG - Intronic
913466542 1:119148872-119148894 TTATTGTCTTAAAAAAAAAAAGG - Intergenic
913942524 1:125121116-125121138 CTGATGAGCTTAAAAAAAAAAGG + Intergenic
914079335 1:144392087-144392109 CTCTTTTCTTTAAAAAAAGATGG + Intergenic
914099844 1:144574415-144574437 CTCTTTTCTTTAAAAAAAGATGG - Intergenic
914431398 1:147622967-147622989 CCCTAGTCCTAAAAAAAAAAAGG - Intronic
914507322 1:148301238-148301260 GTGTTTACCTGAAAAAAAAAAGG + Intergenic
915184019 1:154088632-154088654 CTGTTGTTCTTCATAATAAAAGG + Intronic
915661404 1:157408682-157408704 CTGATGTCCTTATAAAAAGAGGG - Intergenic
915830378 1:159123740-159123762 CTGTTGTGATTTAAAAAGAATGG - Intronic
917098228 1:171421197-171421219 CTGTTTTCCATAAAAGGAAATGG + Intergenic
917104316 1:171477180-171477202 CTGTTGTTCATAAAGTAAAAGGG - Intergenic
917189506 1:172399917-172399939 CTGTTGTTAAAAAAAAAAAAAGG + Intronic
917270442 1:173267149-173267171 CTATTCTCCTTTAAAAAATAAGG + Intergenic
917639195 1:176966181-176966203 TTGTAGTCCTTGAAAACAAAAGG - Intronic
918039288 1:180902602-180902624 CTGGTGTCCTTATAAAATGAGGG + Intergenic
918266786 1:182849991-182850013 CTGATGAAATTAAAAAAAAAAGG - Intronic
918641159 1:186842611-186842633 CTAGTGTCCTTAAAAGAAGAGGG + Intronic
919109860 1:193205206-193205228 CTGATGAGTTTAAAAAAAAAGGG - Intronic
919178876 1:194056615-194056637 CTGGTGTGCTTACAAAAAAGAGG - Intergenic
919488843 1:198178998-198179020 GGCTTTTCCTTAAAAAAAAAAGG - Intronic
919863913 1:201764463-201764485 CTCGTGTCCTTATAAGAAAAAGG - Intronic
920332715 1:205222370-205222392 CTGATAAGCTTAAAAAAAAAAGG + Intergenic
920667511 1:207974198-207974220 CTTTTGTCCTTAAAAAGACAAGG + Intergenic
920702112 1:208225685-208225707 CTGGTGTCCTTATAAAAAGGGGG + Intronic
920739645 1:208568470-208568492 CTTTTGTCCCTAAGAAAATATGG + Intergenic
920887174 1:209940366-209940388 CTATTGTACAAAAAAAAAAAAGG - Intronic
921089419 1:211829868-211829890 TTTTTTTTCTTAAAAAAAAAAGG - Intronic
921437683 1:215145122-215145144 CTGATGTCAATAAAAAATAATGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921671979 1:217935454-217935476 CTGGTGTCCTTATTTAAAAAGGG + Intergenic
921784880 1:219218503-219218525 CTAATGACCTAAAAAAAAAAAGG - Intergenic
922227405 1:223657366-223657388 ATGTTGTTTTTAAAAAAAGAAGG + Intronic
922293391 1:224227862-224227884 CTGCTCTCCTTACAAAAAGAGGG + Intronic
922541589 1:226424333-226424355 CTGTTGTCCTTTTAGGAAAAGGG + Intergenic
922656960 1:227393586-227393608 CTGGTGTCCTTAAAAGAAGAGGG + Intergenic
923330620 1:232920608-232920630 CTGGTGTCCTTATAAAAAGGGGG + Intergenic
923521231 1:234736412-234736434 CTGTTGTCCTGAGAAACAATAGG + Intergenic
923967617 1:239159249-239159271 ATATTGGCCTTAAAAAAAAAAGG - Intergenic
923984867 1:239370119-239370141 CTTTTGTGCTTGTAAAAAAATGG - Intergenic
1062823940 10:555336-555358 ATGTTGTCCTTATGAAAAATTGG - Intronic
1063016600 10:2084151-2084173 CTGGTGTCCTTATAAAAAACAGG + Intergenic
1063248355 10:4247663-4247685 GTGTTGTAATTAAAAAAAAAGGG + Intergenic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1063790207 10:9436176-9436198 CATTTGTCCTTACAGAAAAATGG + Intergenic
1063939454 10:11111959-11111981 CTGTTTTCCTTACAAAAACCAGG - Intronic
1064064259 10:12167443-12167465 CTGTTGAGCTTTAAAAAAATTGG + Exonic
1064227206 10:13497670-13497692 CTATTGTCCTTAGAATAAAATGG + Intronic
1064304327 10:14151822-14151844 CTGCTGCCCTTTAAAAACAAAGG - Intronic
1064516132 10:16150532-16150554 CTGTTGTCCATTTTAAAAAATGG - Intergenic
1064554835 10:16537933-16537955 CTGGTGTCCTTATAAGAAAGAGG + Intergenic
1064834060 10:19505387-19505409 CTGTTGTCCTCATAAAATGAAGG + Intronic
1064950983 10:20849990-20850012 CTATTTTCATTGAAAAAAAAAGG + Intronic
1065045736 10:21746517-21746539 CTCTTCTCTTAAAAAAAAAAGGG + Intergenic
1065445769 10:25796756-25796778 CTGTTGTCCTTTATAATATAGGG - Intergenic
1065660812 10:28002573-28002595 CTGGTGTTCATAAAAAAAAGAGG - Intergenic
1065785479 10:29209273-29209295 TTTTTGTCCTTAAAACTAAAAGG + Intergenic
1066007236 10:31156496-31156518 CTCTTGTCTCAAAAAAAAAATGG + Intergenic
1066209673 10:33224401-33224423 TTTTTTTCCTTAACAAAAAATGG + Intronic
1066591749 10:37002490-37002512 CTGTTGTCCTTTAAACGAAATGG + Intergenic
1067174624 10:43935582-43935604 CTGGTGTCCTTATAAGAAGAGGG - Intergenic
1067273772 10:44816400-44816422 TTCGGGTCCTTAAAAAAAAAGGG + Intergenic
1067514076 10:46921769-46921791 CTGGTGTCCCTATAAAACAAGGG + Intronic
1068782605 10:60937722-60937744 CTGTTGTGTTCAAGAAAAAAAGG + Intronic
1069003769 10:63295059-63295081 CTGAAGTAGTTAAAAAAAAAAGG + Intronic
1069091806 10:64208343-64208365 CTGGTGTCCTTAAAAGAAAAGGG - Intergenic
1069651046 10:70049106-70049128 ATAATATCCTTAAAAAAAAAAGG - Intergenic
1069990543 10:72312775-72312797 CCAGTGTCCTTAAAAAAAAGTGG - Intergenic
1070321354 10:75357116-75357138 CTCCTGTGCTTAAAAAAAAAAGG - Intergenic
1070405502 10:76091249-76091271 CTGTTCTCCTGAAATAAACATGG + Intronic
1070469454 10:76764446-76764468 CTGGTGAACTTAAAAAGAAAAGG + Intergenic
1070664633 10:78334312-78334334 CTGGTGTTCTTATAAGAAAAGGG + Intergenic
1071230991 10:83585502-83585524 TTTTTTTCTTTAAAAAAAAATGG + Intergenic
1071864292 10:89709152-89709174 CTGTTTGCCTTAAAAAATAAAGG - Exonic
1072047157 10:91668492-91668514 CCATTAGCCTTAAAAAAAAAAGG - Intergenic
1072047933 10:91675459-91675481 CTGTTGACTTAAAAAAAATAGGG - Intergenic
1072219098 10:93312646-93312668 TTTTTCTCATTAAAAAAAAAAGG - Intronic
1072489653 10:95891909-95891931 TTTTTTTCTTTAAAAAAAAAAGG + Intronic
1072653313 10:97312494-97312516 CTGGTATCCTTACAAAAAGAAGG - Intergenic
1072814277 10:98489349-98489371 CAGTTGTCTTTAAAACAAACAGG - Intronic
1073347946 10:102798798-102798820 CTGTGGTCCTTACAAGAAAATGG - Intronic
1073939394 10:108677698-108677720 CTGATGTCCTTAAAAAAAAACGG + Intergenic
1074094865 10:110302744-110302766 CTGGTGTCCTGAAACACAAAAGG + Intronic
1074302663 10:112246999-112247021 CTGGTGTCCTTATAAGAAGACGG + Intergenic
1075010663 10:118867127-118867149 CTGAATTCCATAAAAAAAAAGGG - Intergenic
1075189249 10:120291280-120291302 CTGGTGACCTTAAAGAAAAATGG + Intergenic
1075214794 10:120522990-120523012 CAGGTGTCCTTATAAAAGAAAGG + Intronic
1075308022 10:121384956-121384978 CTAGTGTCCTCATAAAAAAAGGG - Intergenic
1075574289 10:123567445-123567467 CTGTCTTTCTTAAAACAAAAAGG - Intergenic
1075600413 10:123763538-123763560 CTTTTGATCTAAAAAAAAAAAGG + Intronic
1075618861 10:123911016-123911038 CTGCTGTCCTTATAAGAAGAGGG - Intronic
1075669820 10:124256728-124256750 CTGTTGTCCTTATAAGAAGAGGG + Intergenic
1075908081 10:126099977-126099999 CTTTTATACTTAAAAAAAAAAGG - Intronic
1075908207 10:126101035-126101057 CTTGTCTGCTTAAAAAAAAAAGG - Intronic
1075993400 10:126857272-126857294 CTGGTGTCCTAAAAAGAAGAAGG - Intergenic
1076051080 10:127333625-127333647 CTTTTGTTCTTGAACAAAAAGGG - Intronic
1076201738 10:128564376-128564398 CTGGTGTCCTTATAAGAAGAGGG + Intergenic
1076303042 10:129442236-129442258 CTGGTGTCCTTATAAAAAGAGGG + Intergenic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1077535416 11:3121799-3121821 CTGGTGTCCTTATAAAAAGGGGG + Intronic
1077546325 11:3171784-3171806 CTGGTGCCCTTATAAAATAAAGG - Intergenic
1077773999 11:5251507-5251529 TTGTTTTACTAAAAAAAAAAAGG + Intronic
1077905784 11:6532429-6532451 CTTTAATCCTTAAAAACAAAAGG + Intronic
1078764380 11:14280273-14280295 CTCTTACCATTAAAAAAAAATGG + Intronic
1078767565 11:14313588-14313610 CTGTTGTCCTTATAAGAGAAAGG + Intronic
1078853159 11:15182296-15182318 CTGTAGCCAATAAAAAAAAAAGG + Intronic
1079613216 11:22458472-22458494 CTGTGAGCATTAAAAAAAAAAGG + Intergenic
1079804720 11:24915784-24915806 TTCTTGCCATTAAAAAAAAATGG + Intronic
1080087327 11:28299967-28299989 CTGGTGTCCTTATAAGAAGAGGG - Intronic
1080167763 11:29260875-29260897 CAGTGGTCCCTAACAAAAAATGG - Intergenic
1080271523 11:30455589-30455611 CTTTTGGCATTAAAAAACAAAGG - Intronic
1080330493 11:31131529-31131551 GTATTATCCTTAAAAAACAATGG + Intronic
1081051902 11:38351628-38351650 CTGTTGTGCTTTAACAAGAAAGG - Intergenic
1081052382 11:38360538-38360560 TTGGTGTCCTTACAAAGAAAAGG + Intergenic
1081170488 11:39863822-39863844 CTAGTGTCCTTATAAAAGAAGGG - Intergenic
1081238843 11:40679264-40679286 CTGTTTCCCTTTAAAAAAAAAGG - Intronic
1081370938 11:42302232-42302254 CTCGTGTCCTTATAAAAAGAAGG + Intergenic
1081581794 11:44357212-44357234 CTCTTGTCTTAAAAAAATAAAGG + Intergenic
1081724462 11:45318319-45318341 CTTTTGTCCGTAAAATAAGAGGG - Intergenic
1082172629 11:49024569-49024591 CTGTTGTTTATAAACAAAAATGG + Intergenic
1082210485 11:49495677-49495699 TTGATGTCCTTATAAAAAAAGGG - Intergenic
1082752637 11:57036375-57036397 TTGTTCTCTTGAAAAAAAAAAGG - Intergenic
1082930942 11:58604260-58604282 CTGATGTCCTTATAAGAATAAGG + Intronic
1085106431 11:73847369-73847391 CTTTTGTCCATTTAAAAAAATGG + Intronic
1085393689 11:76195350-76195372 CTGGTGTCCTTATAAGAAAGGGG + Intronic
1085826119 11:79849495-79849517 ATGTTTACCTTAAAGAAAAAAGG + Intergenic
1085840381 11:80004884-80004906 CTGATGTCCTTAAAAAAAAGAGG - Intergenic
1085896543 11:80646747-80646769 CTGTTGTCCTTTAAAGGAAATGG - Intergenic
1085922805 11:80979157-80979179 CTGTGGTTCTTAAAATATAAAGG - Intergenic
1086431113 11:86737973-86737995 CTGTTGTCAATAACAATAAAGGG - Intergenic
1086639143 11:89129123-89129145 TTGATGTCCTTATAATAAAAGGG + Intergenic
1087042276 11:93813295-93813317 GTGTTTTCATTAAAGAAAAATGG + Exonic
1087401296 11:97669631-97669653 TTGTTTTACTCAAAAAAAAATGG + Intergenic
1087684406 11:101246836-101246858 CTGTTTTTTTTAAAAAAAAAAGG + Intergenic
1088473076 11:110207618-110207640 CTGATTTGTTTAAAAAAAAAAGG - Intronic
1088609755 11:111565805-111565827 CTGGTGTCCTCAAAAAAAAAAGG + Intergenic
1088775462 11:113078284-113078306 CTCGTGTCCTTAAAGAAAAGGGG - Intronic
1089022881 11:115235226-115235248 CTGCTTTTCTGAAAAAAAAAGGG + Intronic
1089568986 11:119389908-119389930 CTAGTGTCCTTATAAAACAAGGG - Intergenic
1089790726 11:120941629-120941651 CTGACGTCCTTATAAAAAGAAGG + Intronic
1090052713 11:123394243-123394265 CTGTTGCCAATATAAAAAAATGG - Intergenic
1090681077 11:129057844-129057866 CTGATGTCCTTACAAGAAGAAGG + Intronic
1090848862 11:130553375-130553397 CTGTTCTCCTTGACAGAAAATGG + Intergenic
1091357920 11:134952213-134952235 CTGTTAGCTTTAAAAACAAATGG + Intergenic
1092687785 12:11070949-11070971 CTCTTTTTCTTAGAAAAAAATGG - Intronic
1092826313 12:12403062-12403084 CTTTTGTGCAAAAAAAAAAAGGG - Intronic
1093123596 12:15301797-15301819 CTATTTTCCTTAAAAAATATTGG + Intronic
1093129883 12:15378313-15378335 CTATTGTCCTTATAAAAGCAAGG + Intronic
1093777989 12:23099679-23099701 TTCTTGTCCCTAAAATAAAAGGG - Intergenic
1093924412 12:24894824-24894846 ATGTTTTCCCTAATAAAAAATGG + Intronic
1094249622 12:28344583-28344605 CAGTTGTCATCAAAAATAAAAGG + Intronic
1094566003 12:31598931-31598953 CTGGTGTCCTTATAAGAAAAGGG + Intergenic
1094746009 12:33345307-33345329 CTTTTTTCTTTAAAAAAAATTGG + Intergenic
1095310229 12:40689729-40689751 ATGTGGTCCTTCAAAAACAAAGG - Intergenic
1095421643 12:42030530-42030552 CTGATGAGCTAAAAAAAAAAAGG - Intergenic
1095563711 12:43595650-43595672 CATTTGTCTTTAAATAAAAAGGG - Intergenic
1095681614 12:44983278-44983300 CTTTTGTCCATTAAAAAAATTGG + Intergenic
1096311869 12:50528427-50528449 CTGCTTTCCAAAAAAAAAAAAGG + Intronic
1096505881 12:52092753-52092775 CTGTTGTCCTGACAAAGCAAAGG - Intergenic
1097815833 12:64072507-64072529 CTGGTGTCCTTATAATAAAAAGG + Intronic
1098085193 12:66834916-66834938 CTCGTCTCTTTAAAAAAAAAAGG + Intergenic
1098278169 12:68834433-68834455 CTCTTGTCTCAAAAAAAAAAAGG + Intronic
1098493364 12:71107649-71107671 CTGTTCTTGTGAAAAAAAAAAGG - Intronic
1099268273 12:80476656-80476678 CTGTTGTCTTAAAAAGAAAGGGG + Intronic
1099584507 12:84500470-84500492 TTTTTCTCATTAAAAAAAAAAGG + Intergenic
1099622606 12:85023958-85023980 CTGTTGTCCACCTAAAAAAAAGG + Intronic
1099801591 12:87463676-87463698 CTGTTGTCCTTATAAGAAGATGG - Intergenic
1100216551 12:92455972-92455994 CTGATGTCCTTATAAGAAAAGGG - Intergenic
1100703427 12:97174263-97174285 TTGTTATCCTAACAAAAAAAGGG - Intergenic
1100751206 12:97699851-97699873 TTGTTTTTTTTAAAAAAAAAAGG - Intergenic
1100878925 12:98994781-98994803 CTGGTGTCCTTATAAGAAAGAGG - Intronic
1101002266 12:100368371-100368393 CTGGTGTCCTTATAAGAAGAGGG - Intronic
1101394137 12:104329305-104329327 GTGGTTTCCTTAAAAAAAAAAGG + Intronic
1101421832 12:104557005-104557027 CTGGTGTCCTTACAAGAAGAGGG - Intronic
1101587038 12:106094112-106094134 CTGTTGATTTAAAAAAAAAAAGG + Intronic
1101626567 12:106448739-106448761 TTATTGTAATTAAAAAAAAATGG - Intronic
1101797294 12:107986981-107987003 CTCATCTCTTTAAAAAAAAATGG + Intergenic
1101823360 12:108201356-108201378 CTGGTGTCCTTATAACAAGATGG - Intronic
1102193039 12:111003484-111003506 CTGTTGTACTTAATATACAATGG - Intergenic
1102412223 12:112729966-112729988 CTGCTGTCCTTATAAAAAGGGGG + Intronic
1102499258 12:113340169-113340191 CTTATATACTTAAAAAAAAAAGG + Intronic
1102731265 12:115112738-115112760 CAGGTGTCCTTATAAAGAAAAGG - Intergenic
1103033982 12:117641554-117641576 CTGATGTCCTTATAAAAAGAAGG - Intronic
1103034834 12:117648012-117648034 CTTTTGTCTTTAAAAAGACAGGG - Intronic
1103109556 12:118263660-118263682 CTTTTGTCCATTAAAAAAATTGG - Intronic
1103173918 12:118845154-118845176 CTAATGTCCTTATAAAAAAGTGG + Intergenic
1103578096 12:121893715-121893737 CTGGTGTCCTCATAAAAGAAAGG - Intronic
1103797796 12:123516755-123516777 CTGGTGTCCTTATAAGACAAAGG + Intronic
1104185950 12:126431525-126431547 CTGATGACCTTAAAAAATACAGG + Intergenic
1104340661 12:127945684-127945706 GTGGTGTCCTTATAAAATAAAGG + Intergenic
1105376134 13:19846752-19846774 TTTTTTTCCTTAAAAAAAAGGGG - Intronic
1105675016 13:22661770-22661792 ATGTTGTCTTTCAAGAAAAAGGG + Intergenic
1106210649 13:27641126-27641148 CTCTTGTGCTTACAAAAAAAGGG + Intronic
1106264089 13:28094403-28094425 CTGTTTAACCTAAAAAAAAATGG + Intronic
1106297657 13:28432110-28432132 ATATAGTGCTTAAAAAAAAAAGG - Intronic
1106333834 13:28764833-28764855 CTGGTGTCCTTATAAGAAAAAGG - Intergenic
1106437876 13:29739867-29739889 CTGGTGTCCTTATAAAAAAGAGG + Intergenic
1106476193 13:30100154-30100176 TTGTTGTCCTTACAAAAAAGGGG - Intergenic
1106528844 13:30568599-30568621 CATTTGTCCTTACAAAAGAAAGG + Intronic
1106531500 13:30597211-30597233 CCAGTGTCCTTATAAAAAAAAGG + Intronic
1106760463 13:32862579-32862601 TTGTTGTCCTGATAAGAAAAGGG + Intergenic
1106887556 13:34206140-34206162 CTATTTTGGTTAAAAAAAAAAGG - Intergenic
1107014811 13:35699648-35699670 GTGTTGTCATTAAGGAAAAAGGG - Intergenic
1107393209 13:39988940-39988962 CTTTTGTTCTTAGAAAAATAAGG + Intergenic
1107852670 13:44586844-44586866 CTGTTCTCCTTAGAAAAAAAAGG + Intergenic
1107935113 13:45340365-45340387 CTGTTGGCCGGAACAAAAAATGG + Intronic
1108041126 13:46340117-46340139 CTGGTGTCCTTATAAGAAAAGGG - Intergenic
1108065850 13:46577029-46577051 CTGCTGGCCTGAAAGAAAAAAGG - Intronic
1108404197 13:50083224-50083246 CTGTCTACCTTCAAAAAAAATGG + Intronic
1109143944 13:58752790-58752812 CTGATATCCTTAAAAGAAAATGG + Intergenic
1109157035 13:58924156-58924178 CTGTTGCCATTGAAAAACAAGGG + Intergenic
1109180070 13:59202990-59203012 TTGTTCTCCTAAAAAAAAAGGGG + Intergenic
1109251178 13:60022637-60022659 CTTGTGTCCTTAAAAGAAAAAGG - Intronic
1109689178 13:65864107-65864129 CTGGTGTCTTTATAAAAGAAAGG - Intergenic
1109871714 13:68341899-68341921 CTGATGGTTTTAAAAAAAAATGG - Intergenic
1110068118 13:71134717-71134739 CTGATGTCCTTACAGAAAGAAGG - Intergenic
1110175629 13:72552270-72552292 CTTGTGTCCTTATAAAAAAGGGG - Intergenic
1110460239 13:75737151-75737173 CTGGTGTCCTTCTAAAAAGATGG + Intronic
1110493068 13:76132187-76132209 TTGTTTTGCTTAAAAATAAAAGG - Intergenic
1110513385 13:76380396-76380418 CTGGTATCCTTATAAATAAAGGG + Intergenic
1110670488 13:78171273-78171295 CCGTTTTCTTTAAAAAGAAATGG - Intergenic
1111413538 13:87909705-87909727 ATGATGTCCTTAAAGAAAAAGGG + Intergenic
1111429181 13:88129639-88129661 CTATTTCCCTTAACAAAAAAGGG + Intergenic
1111697555 13:91643792-91643814 CTGGTGCCCTTAAAAACAAGGGG - Intronic
1111939258 13:94592373-94592395 CTGTAGTCTTTAAAATAAATTGG - Intronic
1112825510 13:103388138-103388160 TTCTTGTCCTGAAAAAAAAAAGG - Intergenic
1113003729 13:105675523-105675545 CTGGTGTCCTTATAAGAAGAGGG - Intergenic
1113059231 13:106303336-106303358 CTGGTGTCCTTAAAACAAGAAGG + Intergenic
1113155117 13:107311487-107311509 CTGTTGTCCATTAGACAAAAGGG + Intronic
1113307728 13:109096342-109096364 CTCATGTCCTGAAAAGAAAAGGG - Intronic
1113558877 13:111260914-111260936 ATGTTGTCATTTAAAAATAATGG + Intronic
1113613503 13:111664691-111664713 CAGGTGTCCTTATAAAAAGAGGG + Intronic
1113658081 13:112082601-112082623 CTGTTGTCCTTTGAAAGAAGGGG - Intergenic
1113761500 13:112850657-112850679 TGATTATCCTTAAAAAAAAAAGG + Intronic
1114340031 14:21733634-21733656 CTGGTGTCCTTACAAAAAGGGGG - Intergenic
1114478815 14:23018080-23018102 CTGGTGTCCTTATAAGAAGAGGG + Intronic
1114898201 14:27021539-27021561 ATCTTATCCTTTAAAAAAAATGG + Intergenic
1115142799 14:30193178-30193200 CAGTTTCCCATAAAAAAAAAAGG + Intergenic
1115815635 14:37161625-37161647 CTGGTGTCCTTATAAGAAGAGGG + Intronic
1115910314 14:38249271-38249293 CTGGTGTCCTTATAAGGAAAGGG + Intergenic
1116028677 14:39544372-39544394 ATGTTATCCATAAAGAAAAAAGG - Intergenic
1116373358 14:44164943-44164965 ATGTTTTCTGTAAAAAAAAATGG - Intergenic
1116594936 14:46829054-46829076 TTGTTGTCTTAAAAAAAAGAAGG - Intergenic
1116822630 14:49640337-49640359 AAGCTATCCTTAAAAAAAAATGG + Intergenic
1116976028 14:51116971-51116993 TTTTTTTCTTTAAAAAAAAATGG - Intergenic
1117218716 14:53579508-53579530 GTATTGTCCTAAAAAGAAAAAGG - Intergenic
1117834874 14:59793415-59793437 CTTCTGTACTTAAGAAAAAAAGG - Intronic
1117907228 14:60602848-60602870 CTCTTGTTCCTAACAAAAAATGG + Intergenic
1118039661 14:61903116-61903138 CTGATGTCCTTATAAGAAGATGG - Intergenic
1118496594 14:66313759-66313781 CTGCTGTCCTTACAAAAAGGGGG - Intergenic
1118715766 14:68558686-68558708 CTGGTGTCCTTATAAGAAGAGGG - Intronic
1119153472 14:72387238-72387260 CTGGTTTCCTTATAAAAAAAAGG + Intronic
1119270926 14:73303787-73303809 CGGTTTTCTTTGAAAAAAAAAGG - Intronic
1119456525 14:74760720-74760742 CTGGTGTCCTTAAAATAAGATGG - Intergenic
1120024618 14:79569019-79569041 CTCTTAGACTTAAAAAAAAATGG + Intronic
1120343519 14:83253518-83253540 ATGATTTCTTTAAAAAAAAAAGG - Intergenic
1120796364 14:88637352-88637374 GTGTTGTCTTTCAAAATAAAGGG + Intronic
1121165341 14:91791121-91791143 CTGTCTTCCTCAAAAAAAAGGGG + Intronic
1121487132 14:94325540-94325562 ATGTTTTCTTTAAAAAATAATGG + Intergenic
1121683852 14:95817104-95817126 CAGTTGTCCATAACAAAGAATGG + Intergenic
1122069482 14:99196357-99196379 CTGTGGACCTGAAAAAAACAGGG + Intronic
1122224001 14:100262154-100262176 CCGTTCTCCAAAAAAAAAAAAGG + Intronic
1122837804 14:104438600-104438622 CAGTTGTCCTTATAAAAAGAAGG + Intergenic
1124015939 15:25875794-25875816 CTGGTGTCCTTACAAAAAGGGGG - Intergenic
1124029436 15:25996410-25996432 CTTTTGTCCATTAAAAAAATGGG + Intergenic
1124712292 15:32024506-32024528 CTGGTGTCCTTATAAGAAGAGGG + Intergenic
1125177126 15:36837060-36837082 CTGATGTCTTTATAAGAAAACGG - Intergenic
1125408992 15:39385003-39385025 CTGGTGTCCTTATAAGAAGAAGG + Intergenic
1125454245 15:39841450-39841472 CTGGTGTCCTTATAAAAAAGGGG + Intronic
1125663743 15:41414622-41414644 CTGTTCTCAAAAAAAAAAAAAGG - Intronic
1126147211 15:45486465-45486487 CCTTTGTCTTTAAAAAACAAAGG - Intronic
1126187334 15:45842960-45842982 CTCCTAGCCTTAAAAAAAAAGGG + Intergenic
1126382493 15:48063680-48063702 CAGATGTCCTTATAAGAAAAAGG + Intergenic
1126409591 15:48358591-48358613 CTGCTGTGTTTAAACAAAAATGG + Intergenic
1126465492 15:48957829-48957851 CTGATGTTCTTATAAAAAAGAGG + Intronic
1126765682 15:52008812-52008834 CTGGTGTCCTGGAAGAAAAATGG - Intronic
1126853057 15:52810145-52810167 TTTTTGTACTTAAGAAAAAATGG - Intergenic
1126893203 15:53228721-53228743 CTGTTGCCCATAACAAAATAGGG - Intergenic
1127362261 15:58254639-58254661 CTGGTGTCCTTGTAAAAGAAAGG - Intronic
1127651810 15:61016342-61016364 CTGTGGTTCTTAAAATAGAATGG + Intronic
1127778091 15:62284477-62284499 ATGTTTTTTTTAAAAAAAAAGGG - Intergenic
1127926338 15:63547210-63547232 CTGTTTTCCTTAAAGAATAGCGG + Intronic
1128355436 15:66923272-66923294 CTTTTGTGCTTAAAAAGACATGG - Intergenic
1128478200 15:68015287-68015309 CTTTTGCCCTAAGAAAAAAATGG - Intergenic
1129396708 15:75253568-75253590 CTGTTTCCATTTAAAAAAAAAGG + Intergenic
1129907240 15:79196965-79196987 CTGTTGTCCTTACAAGAATAAGG - Intergenic
1129988745 15:79942846-79942868 TGGTTGTAATTAAAAAAAAAAGG + Intergenic
1130212786 15:81941101-81941123 ATGTTTTTTTTAAAAAAAAAAGG + Intergenic
1130286939 15:82563826-82563848 TTCCTGTCATTAAAAAAAAATGG - Intronic
1130372021 15:83293101-83293123 CTACTATCCTTAAAGAAAAATGG - Intergenic
1131030416 15:89181583-89181605 CTGTGGTCTTTGAAAAAATATGG - Intronic
1131055756 15:89373460-89373482 CCTTGGTACTTAAAAAAAAAAGG + Intergenic
1131545933 15:93315493-93315515 CTGGTGTCCTTATAAAAAGGGGG - Intergenic
1133330055 16:4967310-4967332 CTGGTGTCCTTATAAAAAAACGG - Intronic
1133455229 16:5936032-5936054 CTCTTGACATAAAAAAAAAATGG - Intergenic
1133456714 16:5948550-5948572 CTGGTCTCCTTAAAAGAAGAGGG + Intergenic
1133813989 16:9182566-9182588 CTGATGTCCTTACAAGAAGAGGG - Intergenic
1134840644 16:17399020-17399042 CTGGTGTCCTTATAAAAAGGGGG - Intronic
1135504969 16:23028324-23028346 CTGTTGTAAGAAAAAAAAAATGG - Intergenic
1135583803 16:23651577-23651599 CTGTTTTCCTCCAAAAGAAAAGG + Intronic
1135585886 16:23670547-23670569 CGGTTCTCCTGAAAAAAAATTGG + Exonic
1136109333 16:28054815-28054837 CAGATGTCTTTAAAAAAAAATGG + Intronic
1136262129 16:29085568-29085590 CTGTCTTCTTTAAAAAAAAAAGG + Intergenic
1136696025 16:32082960-32082982 CTGATGAGCTTAAAAAAAAAAGG - Intergenic
1136796519 16:33026214-33026236 CTGATGAGCTTAAAAAAAAAAGG - Intergenic
1137814984 16:51389994-51390016 CTGCCGTCCTTATAAGAAAAAGG - Intergenic
1137958331 16:52855517-52855539 GTGTTTTCATTTAAAAAAAAAGG - Intergenic
1138477490 16:57280488-57280510 CTTTTGGTTTTAAAAAAAAAAGG - Intronic
1138861009 16:60757460-60757482 CACTTGTCCTTAAAAAACATAGG + Intergenic
1139090995 16:63647296-63647318 AGGTTGTCCCTAAAAAAAAATGG - Intergenic
1139228788 16:65260573-65260595 CAGTTGTCCTTAAAAAATTAAGG + Intergenic
1140141132 16:72259045-72259067 CTGGCGTCTTTATAAAAAAAGGG + Intergenic
1140559676 16:75964072-75964094 CTGGTGTCCTTATAAGAAGAGGG - Intergenic
1140669943 16:77268451-77268473 CTATTTTCCTGAAAAAAAACAGG - Intronic
1140995652 16:80256922-80256944 CTGATGTCCTTATAAAAAAGAGG + Intergenic
1141050352 16:80756101-80756123 ATGTTGTCATTAAATAAGAAAGG + Intronic
1141353301 16:83319234-83319256 CTGTTGTCTTTTAAAAATATTGG + Intronic
1141716899 16:85732061-85732083 CAGTTGTCCTTAAAAGAGAAGGG + Intronic
1141761980 16:86034487-86034509 CTGAGGTCCTTAAAAGAAGAGGG + Intergenic
1141870843 16:86784462-86784484 CTGGTGTCCTTATAAAAAGACGG + Intergenic
1142566725 17:844881-844903 TTGTTTTCATTAAAAAAAACAGG - Intronic
1143038977 17:4018426-4018448 CTGTTAAATTTAAAAAAAAAAGG - Intronic
1143701240 17:8661845-8661867 CTGGTGTCCTTATAAGAAGAGGG - Intergenic
1143961538 17:10725263-10725285 GTGTTGTCCTAAAACAAAAAGGG - Intronic
1144576057 17:16430173-16430195 CTGTATACTTTAAAAAAAAAAGG - Intronic
1144747546 17:17625946-17625968 ATATTGTTCTTAAAAAAAAAAGG - Intergenic
1145054922 17:19696142-19696164 CTGGTGTCCTTATTAAAAGAGGG + Intronic
1145834581 17:27944615-27944637 CTAGTGTCCTTATAAAAGAAAGG + Intergenic
1145985066 17:29040337-29040359 CTGTTTTCCTAAGAACAAAAGGG + Intronic
1146614431 17:34342544-34342566 CTGTTTTGCTTAAAAAAGACAGG - Intergenic
1146974959 17:37103271-37103293 CTGTTCTCCTGAAAGAAAGAAGG + Intronic
1147126435 17:38372804-38372826 CTGTTGTAATAAAAGAAAAAAGG + Intronic
1148663452 17:49355974-49355996 CTTTTATCCTTAAATAAAGAGGG - Intronic
1148926592 17:51091647-51091669 CCCTAGTCCTTAAAAAAAAGTGG - Intronic
1148927661 17:51101614-51101636 CTGTCCCCCTCAAAAAAAAAAGG - Intronic
1149006391 17:51810619-51810641 CCTTTGTCCTTCAAATAAAATGG - Intronic
1149147881 17:53519419-53519441 CCTTTGTATTTAAAAAAAAAAGG - Intergenic
1149153903 17:53603284-53603306 TTGATGTTCTTAAACAAAAACGG - Intergenic
1149763359 17:59253055-59253077 GTGTTTTCCATGAAAAAAAAAGG - Intronic
1150176012 17:63056895-63056917 CTGTTCTCCTAAACAATAAAAGG - Intronic
1150392739 17:64799595-64799617 TTTTTGTAATTAAAAAAAAAGGG + Intergenic
1150700934 17:67446406-67446428 CTGTTTTCAGAAAAAAAAAAAGG + Intronic
1150728959 17:67675123-67675145 CTGTTTTAGTTAAAAATAAATGG + Intronic
1150838687 17:68588118-68588140 CTTTTGACGTAAAAAAAAAAAGG + Intronic
1151278113 17:73051240-73051262 CTGGTGTCCTTATAAGAAGAGGG - Intronic
1151412208 17:73938496-73938518 ATGTTTTCCTTAAAAAAAAAAGG + Intergenic
1151420661 17:73995059-73995081 CTGGAGTCCTTGAAAAAAGAGGG - Intergenic
1152175992 17:78787864-78787886 CTTGTGTCCTTACAAAAAGAGGG + Intronic
1152196655 17:78922507-78922529 CTGCTGTCCTTAGAAGAACAGGG + Intronic
1152449948 17:80372341-80372363 TTCTTGTCCTTAAAATAAAAAGG + Intronic
1152675912 17:81641156-81641178 CTCTTGTCTCAAAAAAAAAAAGG + Intronic
1153104652 18:1512268-1512290 CTCTTTTCTTAAAAAAAAAAAGG + Intergenic
1153487576 18:5615837-5615859 GGGTTGTCCTTCAAGAAAAAAGG - Intronic
1153987498 18:10366642-10366664 CTGATGCCCTAAAACAAAAAAGG + Intergenic
1155992851 18:32298402-32298424 CTTTTGCTATTAAAAAAAAAAGG - Intronic
1156171911 18:34494868-34494890 CTGATTTCTTTAAAAAATAATGG + Intronic
1156260200 18:35439238-35439260 CTGGTGTCCTTATAAGAAGAGGG + Intergenic
1156669820 18:39454853-39454875 ATGATCTCTTTAAAAAAAAATGG + Intergenic
1156711608 18:39953573-39953595 CTGTTGTGTTTCAAAAAATAGGG + Intergenic
1157222005 18:45835068-45835090 CATTTGTCCAGAAAAAAAAAAGG + Intronic
1157569775 18:48704674-48704696 CTGATGTCCTTGTAAAAACAAGG - Intronic
1157772114 18:50358382-50358404 CTATTGTCTTTACAAAAAAGAGG - Intergenic
1158192918 18:54850872-54850894 GTGTTGTATTTAAAAGAAAAGGG + Intronic
1158214079 18:55080899-55080921 CTGGTGTCCTTATAAGAAGAGGG - Intergenic
1158601585 18:58860432-58860454 TTGATGTTCTTAAAAAGAAAAGG + Intergenic
1158869411 18:61670138-61670160 CTGCTGTCCTAATAAAAGAAAGG - Intergenic
1159064571 18:63555628-63555650 CTGCTGTCTTTAAAAGAAGAGGG + Intergenic
1159603436 18:70450746-70450768 ATTTTCTTCTTAAAAAAAAAAGG - Intergenic
1159653412 18:71003919-71003941 CTGTTGACTTTAAGAAAACAGGG - Intergenic
1159921725 18:74232688-74232710 CTGGTGTCCCTATTAAAAAAAGG + Intergenic
1159977250 18:74728915-74728937 CGGTTGTTTTTAAAAAAGAAGGG + Intronic
1160186304 18:76679122-76679144 CTGGTGGCCTTAAAAGAAGAGGG + Intergenic
1160262833 18:77311189-77311211 CTGTTTTCCTGAAAAATAAAAGG + Intergenic
1160345528 18:78128979-78129001 CTGCTGTCCTTTTAAAAAGAGGG + Intergenic
1160389267 18:78518023-78518045 CTGGTGTCCTTATAAGAAGAAGG + Intergenic
1160596647 18:79980067-79980089 CTGGTGTCCTTAGAGGAAAATGG + Intronic
1161132753 19:2601267-2601289 CTGTTGTCCCTAAAAACCATGGG + Intronic
1161507763 19:4652996-4653018 CTGGGGTCCTTAAAAAAAGGGGG + Exonic
1162456994 19:10791393-10791415 CTGGTGTCCTTATAAAAAGGGGG - Intronic
1163239184 19:16048974-16048996 CTTGCATCCTTAAAAAAAAAAGG + Intergenic
1163659824 19:18570023-18570045 CTGTTGTCTCAAAAAAGAAAAGG + Intergenic
1163699348 19:18779520-18779542 ATGTAGGACTTAAAAAAAAATGG + Exonic
1164509578 19:28886333-28886355 CTGTTGACCTTTACAAAAAGGGG - Intergenic
1164522100 19:28987475-28987497 ATCTTGTCTTTAAAAAAAAGAGG - Intergenic
1164611804 19:29637389-29637411 CTGACATCCTTAACAAAAAATGG + Intergenic
1164955861 19:32383664-32383686 CTTTACTCCTTAAAAAAGAAAGG + Exonic
1165037104 19:33041597-33041619 CTGTTGTCGTTAAGAGAACAAGG + Intronic
1165197331 19:34114881-34114903 CCTTTGTACTTAAAAAAAAAAGG - Intergenic
1165416223 19:35695310-35695332 CTCTTGTCTCAAAAAAAAAAAGG - Intergenic
1166062852 19:40337641-40337663 CTATTGTCTTAAAAGAAAAATGG - Intronic
1166212054 19:41313070-41313092 CTGTTATCTTAAAAAAAAAGAGG - Intronic
1166964834 19:46522993-46523015 TTGTTGTCATTAAAAAAAAGTGG + Intronic
1167681829 19:50928069-50928091 CTGGTGTCCTTATAAAAACAGGG - Intergenic
1167800671 19:51739333-51739355 CTGGTGTCCTTATGAAAAAAGGG - Intergenic
1202653257 1_KI270707v1_random:25668-25690 ACGTTATCTTTAAAAAAAAATGG + Intergenic
925336966 2:3105882-3105904 CTGGTGTCCTTAGAAGAGAAGGG - Intergenic
925376947 2:3393163-3393185 ATTTAGTCCTTAAAAAACAAGGG + Intronic
926064905 2:9830851-9830873 CTGTTGTCATTAAACAGTAAAGG - Intergenic
926357633 2:12056115-12056137 CTGGTGTCCTTACATGAAAAAGG - Intergenic
926605018 2:14888454-14888476 CTATGGTCAATAAAAAAAAAAGG - Intergenic
926721802 2:15966525-15966547 CTGTTGTCCTTATAATAAAAGGG - Intergenic
926936667 2:18092677-18092699 CGGTTGTCCTGGAAAAAGAATGG - Intronic
927114871 2:19889825-19889847 CTGATGTCCTTACAAGGAAAAGG - Intergenic
927137745 2:20109530-20109552 GTATTATTCTTAAAAAAAAAAGG - Intergenic
927185976 2:20482801-20482823 TTGCTTTCCTTAAAAAGAAAAGG - Intergenic
929136982 2:38634245-38634267 GTGTTGTCCTTCACAAAAAAAGG - Intergenic
929179522 2:39020599-39020621 CAGTAGTTCTTAAAAACAAATGG + Intronic
929846222 2:45531128-45531150 CTGCTTTCCTTGAAAAGAAAAGG + Intronic
930257151 2:49105472-49105494 CTTTTGTGCTTAAAAAACAAAGG + Intronic
930308896 2:49713201-49713223 CAGTTGTCCTTGAATAAAACAGG + Intergenic
930610874 2:53541950-53541972 CTATTGAAATTAAAAAAAAATGG - Intronic
930805810 2:55488779-55488801 CTGATGTCCTTATAAAGAAGAGG + Intergenic
930948783 2:57111182-57111204 CTGCTGTTCTTATAACAAAAGGG - Intergenic
931080233 2:58760980-58761002 ATATTTTCATTAAAAAAAAAAGG - Intergenic
931151590 2:59580207-59580229 CTGGAGTCCTGGAAAAAAAACGG - Intergenic
931659553 2:64546192-64546214 TTGTTACCATTAAAAAAAAAAGG - Intronic
931704594 2:64937032-64937054 CTGTTGTCCATACAAGAAACTGG - Intergenic
932047429 2:68363921-68363943 CTGGTGTCCTTATAAGAAAAGGG - Intergenic
932059848 2:68485259-68485281 CTGATGTCATTAAAGACAAAAGG - Intronic
932192932 2:69756282-69756304 TTGCTGTGCCTAAAAAAAAAGGG + Intronic
932195443 2:69779156-69779178 CTTATTTCATTAAAAAAAAAAGG - Intronic
932539166 2:72633498-72633520 CTGGTGTAATTAAAACAAAATGG + Intronic
932896935 2:75649415-75649437 CTGGTAAGCTTAAAAAAAAAAGG - Intronic
932948075 2:76261147-76261169 CTTTTTTCTTGAAAAAAAAAAGG + Intergenic
933296362 2:80495626-80495648 CTGGTGTCCTTATAAAAAGATGG + Intronic
934122558 2:88854213-88854235 CTGGTGTCCTTATAAGAAGAAGG - Intergenic
934124449 2:88873201-88873223 CTGTTGCCCTGTAAAAAAATTGG - Intergenic
934157714 2:89218675-89218697 CTGTTCTGCTTAGAAATAAAAGG + Intergenic
934209551 2:89963751-89963773 CTGTTCTGCTTAGAAATAAAAGG - Intergenic
934980730 2:98837446-98837468 GCGTTGTCTTAAAAAAAAAAAGG + Intronic
935004736 2:99061879-99061901 CTGGTGTCCTTATAAGAATAGGG + Intronic
936273365 2:111069453-111069475 CTGATGTCCTTATAAGAAGAGGG - Intronic
936598448 2:113872317-113872339 CTGGTATCCTTACAAAAAAGGGG + Intergenic
936727565 2:115339287-115339309 TTGATGTCATTAAAAAAAAATGG - Intronic
936888486 2:117341213-117341235 CTGTTATCCTTATGAGAAAAGGG - Intergenic
937022475 2:118670683-118670705 TTGTTTTCCAAAAAAAAAAAGGG + Intergenic
937367770 2:121276856-121276878 CTTTTATGCTTAAAAGAAAATGG - Intronic
937652138 2:124331081-124331103 CTGTTGTCTTTAAAGATATATGG - Intronic
937656048 2:124377711-124377733 TTATTATCCATAAAAAAAAAAGG - Intronic
938196529 2:129333804-129333826 CTGCTGTCCTTATAAAAATGGGG - Intergenic
938255362 2:129855198-129855220 CTGGTGTCCTTAATAAGAAGAGG - Intergenic
938652353 2:133396629-133396651 CTGATGTCCTTATAAAAAGGGGG - Intronic
939409099 2:141801220-141801242 CTGTTTTCCTCAGAAAATAATGG + Intronic
939418252 2:141929473-141929495 CTTCTGTCTTTTAAAAAAAATGG - Intronic
939791614 2:146585202-146585224 CTGGTGTCTTTATAAAAAGAAGG - Intergenic
939906787 2:147926106-147926128 TTGTTGTGCATAAAAAAAAGAGG + Exonic
940020824 2:149154232-149154254 CTGTTATCCTTATAAGAGAAAGG + Intronic
940164441 2:150753799-150753821 ATGTTGTCCTTCAAACAAAAGGG - Intergenic
940200591 2:151145909-151145931 CTGTAGTAGTTAAAAAAAAAAGG - Intergenic
940230877 2:151450155-151450177 CTGGTGCTATTAAAAAAAAAAGG - Intronic
940295987 2:152124555-152124577 CTGTTGTCCTGAAAATAAGTAGG - Intronic
940438994 2:153691899-153691921 CTGATATTCTTAAAAAAACATGG + Intergenic
940669512 2:156650043-156650065 CTGTGGTCCTTCACAAAAATTGG - Intergenic
940692898 2:156941555-156941577 ATGTTTTCCTGAAAAAAAAATGG + Intergenic
940773918 2:157867128-157867150 GTGTTGCTCTTAAAAGAAAATGG - Intronic
940807576 2:158205307-158205329 CTGTTGTCATTTACAGAAAAGGG + Intronic
941037359 2:160582875-160582897 CTGTGTTCTTAAAAAAAAAAAGG + Intergenic
941317398 2:164010175-164010197 CAGTTGTCAGTAAAAGAAAAGGG - Intergenic
941613155 2:167685922-167685944 CTGCTTTACTTAAATAAAAAAGG + Intergenic
941713939 2:168744370-168744392 CTGATAGCCTGAAAAAAAAAAGG - Intronic
942125296 2:172818807-172818829 CTGTTGACCTGGAAAAGAAAAGG - Intronic
942190117 2:173461499-173461521 ATGTCGACATTAAAAAAAAATGG + Intergenic
942555132 2:177164941-177164963 CTTTTGTCTTAAAAAAAAAAAGG + Intergenic
942791531 2:179766636-179766658 CTGATAACCTTACAAAAAAACGG - Intronic
942860029 2:180598332-180598354 CTGTTTTCCTTACAAAAAATGGG - Intergenic
943081052 2:183259671-183259693 CTGTTGTATTTTAAAATAAAAGG + Intergenic
943864953 2:192917551-192917573 CTTTTGACCTTATAGAAAAATGG - Intergenic
944301071 2:198125534-198125556 CTCTTGTACTTGAAAAAAAATGG - Intronic
944627643 2:201588634-201588656 CTGATGTGCTTCAAAAACAATGG + Intronic
944959128 2:204850182-204850204 CTGTTTTCCATGAAACAAAATGG - Intronic
945096520 2:206224361-206224383 CTGTTTTAATTGAAAAAAAAAGG - Intergenic
945135196 2:206619516-206619538 TTCTTTTCCTAAAAAAAAAAGGG - Exonic
945400704 2:209378994-209379016 CTGATATCCATAAAAATAAATGG - Intergenic
945889273 2:215410985-215411007 TTCTTGTCCTGAAAAAACAAAGG + Intronic
945904850 2:215580280-215580302 TTGTTTTACTTAAAACAAAATGG + Intergenic
946007678 2:216539431-216539453 CTGGTGTCCTTGAAAGAAGAGGG - Intronic
946538136 2:220653757-220653779 CTATTGTCCTGAGAAGAAAAAGG - Intergenic
947067139 2:226240450-226240472 CTGGTGTCCTTATAAAAGAGAGG + Intergenic
947955305 2:234184717-234184739 CTGGTGTCCTTACAAGAAGAAGG + Intergenic
948031159 2:234818700-234818722 CTGGTGTCCTTATTAGAAAAAGG + Intergenic
948350581 2:237337273-237337295 CTGTTTTCCTAAAGATAAAAAGG + Intronic
948371464 2:237492224-237492246 CTGATGAACTTCAAAAAAAAAGG + Intronic
949061107 2:241957912-241957934 CTGGTGTCCTTATAAGAGAAAGG - Intergenic
1169501591 20:6165921-6165943 ATCTTGTTCCTAAAAAAAAATGG + Intergenic
1169639106 20:7728831-7728853 ATGTTTTCTTTAAAAATAAAGGG - Intergenic
1169655705 20:7920408-7920430 ATGTTCTCCCTACAAAAAAATGG - Intronic
1169811088 20:9610020-9610042 GTGTTGTTCTTAGAAAACAAAGG - Intronic
1170084232 20:12511201-12511223 ATGTTGACTTTAAAAATAAATGG + Intergenic
1170117419 20:12875325-12875347 CTGATTTCCATAAACAAAAAAGG - Intergenic
1170391282 20:15877455-15877477 TTGTTGTTCTTTTAAAAAAAAGG - Intronic
1170451729 20:16490250-16490272 CTGGTGTCCTTATAAGAAGAGGG + Intronic
1170488714 20:16847735-16847757 ATGCTGTTTTTAAAAAAAAATGG - Intergenic
1170560979 20:17558158-17558180 TTTTTCTCCTAAAAAAAAAAAGG - Intronic
1172806791 20:37617792-37617814 CTGGTGTCCTTATAAGAAGAGGG + Intergenic
1174117727 20:48238875-48238897 CTCATGTCTTTATAAAAAAATGG + Intergenic
1174645726 20:52084024-52084046 CTGTTGTCTTACAATAAAAAAGG - Intronic
1174746462 20:53068078-53068100 CTGGTGTTCTTAAAAATCAAAGG - Intronic
1174758105 20:53179904-53179926 TTGTTCTCCTTTAAAAAAGATGG + Intronic
1174978430 20:55362041-55362063 CTGCTGTCATTATAAGAAAAAGG + Intergenic
1175666072 20:60861129-60861151 CTATTGTGCTTATAAAAAGAGGG + Intergenic
1175671892 20:60910452-60910474 CTGGTGTCCTTATCAGAAAAGGG + Intergenic
1175726886 20:61324575-61324597 CTGCTGTCCTTACAAGAAGAGGG - Intronic
1175741334 20:61421639-61421661 ATGTTATACTTCAAAAAAAAAGG + Intronic
1175761379 20:61564105-61564127 CTGATGTCCTTATAAGAGAAAGG - Intronic
1176164668 20:63666436-63666458 CTGCTGTCCTCAAAAGAACAAGG - Intronic
1176700341 21:10040332-10040354 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
1176896698 21:14387052-14387074 CTGGTATCCTTATAAGAAAAGGG + Intergenic
1177233732 21:18358524-18358546 CATTTGCTCTTAAAAAAAAATGG - Intronic
1177504737 21:22005875-22005897 CTGATGTTCTTATAAAAAAGAGG + Intergenic
1177644074 21:23879760-23879782 CTGGTGTCCTTATAAAAAGGGGG - Intergenic
1177935362 21:27338529-27338551 CTGATGTCCTTCAGAAAAAAAGG + Intergenic
1178123953 21:29497479-29497501 CTGGTGTCCTTACAAGAGAAAGG - Intronic
1178802268 21:35807212-35807234 CTGGTGTCCTTATAAAAATAAGG + Intronic
1178817574 21:35945808-35945830 CTGCTGTCCTTACAAAAAAGGGG + Intronic
1178967738 21:37139196-37139218 CTGTTTTCCTAGAAAAACAAAGG + Intronic
1179186594 21:39089699-39089721 CTGATGTCCTTATAAGAAGAGGG + Intergenic
1179287315 21:39988983-39989005 CTGGTGTCTTTATAAGAAAAGGG - Intergenic
1179549322 21:42133751-42133773 CTGGTGTCCTTATAAAAAGAAGG - Intronic
1179588657 21:42390418-42390440 CTGTTGCCCTTATAAAAAGGGGG + Intronic
1179772130 21:43629143-43629165 ATGTAGTTCTTAAAAAAAATAGG - Intronic
1180419541 22:12800919-12800941 AGGTTATCTTTAAAAAAAAATGG + Intergenic
1180648558 22:17359936-17359958 CTGTTGGCCTTAAAGGAAAAAGG + Intronic
1180677962 22:17601514-17601536 TTTTTTTCCTTAAAAAAAATGGG - Intronic
1181878369 22:25957807-25957829 CAGTTGTCCTTATAAGAAAAAGG - Intronic
1181972680 22:26704214-26704236 CTATTTTCCAAAAAAAAAAAAGG - Intergenic
1182243736 22:28938285-28938307 GTGTTGTCCATTAAAAATAATGG - Intronic
1182274071 22:29173637-29173659 CTGGTTTGCTTTAAAAAAAACGG + Intergenic
1182788158 22:32925256-32925278 CTGGTGTCCTTATAAGAAGAGGG - Intronic
1182981358 22:34674435-34674457 CTGCTGTTCTTCTAAAAAAATGG - Intergenic
1183002581 22:34873938-34873960 CTGGTGTCCTTATAAGAAGAGGG - Intergenic
1183128676 22:35811379-35811401 GTGGTGTCCTTATAAGAAAAGGG + Intronic
1184377261 22:44121953-44121975 ATATTGTACTTAAAAAATAATGG - Intronic
1184639198 22:45860120-45860142 CTGGTGTCCTTGTAAGAAAAGGG - Intergenic
1184674259 22:46031981-46032003 CTTTGGTTCTTAAAACAAAACGG + Intergenic
1185208826 22:49555322-49555344 CTGGTGTCCTTATAAAAAGAAGG + Intronic
1203324737 22_KI270738v1_random:3372-3394 CTGATGAGCTTAAAAAAAAAAGG - Intergenic
949152724 3:790182-790204 CTGTTGACCTTAACAAAGTAGGG - Intergenic
949487687 3:4555497-4555519 CTATTGACATTAACAAAAAATGG - Intronic
949507622 3:4741970-4741992 CTGTTGGCATTAAAGAAAGAGGG + Intronic
949734885 3:7160524-7160546 CTGAGGCCCTTAAAAAAGAAAGG - Intronic
949840481 3:8314651-8314673 CTATTGTCCTTACAAGAAGAGGG + Intergenic
950169896 3:10831186-10831208 CTGTTGTTTAGAAAAAAAAATGG - Intronic
950299304 3:11861707-11861729 CTCTTGTCAAAAAAAAAAAAAGG - Intergenic
950395889 3:12733781-12733803 CTGTTCTCATCATAAAAAAAGGG + Exonic
950969462 3:17171629-17171651 CTGGTGTCCTTATAAGAAGAGGG - Intronic
951001103 3:17560609-17560631 ACCTTGTCTTTAAAAAAAAAAGG + Intronic
951107731 3:18765079-18765101 CCGTTGTCATCAAAAATAAATGG + Intergenic
951464059 3:22982921-22982943 CTGCTCCACTTAAAAAAAAATGG - Intergenic
951725644 3:25755306-25755328 CTGAAGTCCTTAATTAAAAAGGG + Intronic
951816199 3:26757714-26757736 CTGTTATCCTTTATCAAAAATGG + Intergenic
953184765 3:40627809-40627831 CAGTTGTCCTTGAAAACCAATGG + Intergenic
954186916 3:48924318-48924340 ATCTTCTACTTAAAAAAAAAAGG - Intronic
954522451 3:51241537-51241559 CTGGTGTCCTTAAAATAGACGGG - Intronic
954974919 3:54684267-54684289 CTGGTGTCTTTATAAAAAGATGG - Intronic
955193150 3:56781040-56781062 CTGGTGTCCTTATAAGAAGAGGG + Intronic
955472017 3:59295786-59295808 CTGTTGTCCTGAAAAACACCTGG + Intergenic
955510570 3:59676565-59676587 CTGATGAGCTAAAAAAAAAATGG + Intergenic
955873588 3:63466294-63466316 CTGTTGTACTTAAATAAACAAGG + Intronic
956147719 3:66208356-66208378 ATGATTTCCTTTAAAAAAAAAGG - Intronic
956381404 3:68668153-68668175 CTGTTTTCCTTATAAGAAAGAGG - Intergenic
956689589 3:71863653-71863675 CTTATGTCATTAAAAAAAGAGGG + Intergenic
956784574 3:72631773-72631795 TTCTGTTCCTTAAAAAAAAAAGG - Intergenic
956806538 3:72819442-72819464 ATCTTGTCTTAAAAAAAAAATGG - Intronic
956927393 3:74003876-74003898 CTGGTGTCCTTATAAAAAGATGG + Intergenic
956955452 3:74333559-74333581 CTGTTGTCCTTATAAAAAGAAGG - Intronic
957286076 3:78219103-78219125 CTGGTGTCCTTGTAAAAAGAGGG - Intergenic
957717782 3:83953409-83953431 CTATTGTTCTTAAACATAAAAGG - Intergenic
958485594 3:94703686-94703708 CTGGTGTCTTTATAAGAAAAAGG - Intergenic
958507117 3:94993885-94993907 TTCTTGTACTTAAAAAAAAAAGG + Intergenic
958834766 3:99132007-99132029 GTGTTGTCATTAAAAGTAAAGGG - Intergenic
959018059 3:101158367-101158389 CTGGTGTCCTTATACAAATAGGG + Intergenic
959308738 3:104702792-104702814 CTGTAGGCCTTAGAAATAAAGGG - Intergenic
959389240 3:105753366-105753388 CTGTTTTTTTTAAAAAAAAAAGG + Intronic
959780629 3:110228549-110228571 TTTTGGTCATTAAAAAAAAAAGG + Intergenic
960671140 3:120156324-120156346 CTGGTATCCTTAAAAAAAAGGGG + Intergenic
961028237 3:123579996-123580018 CTATTATACTTAAAATAAAAAGG + Intronic
961849507 3:129801282-129801304 TTGTTGAATTTAAAAAAAAAAGG - Intronic
962644159 3:137419745-137419767 GTGTTGTCTTTATAAGAAAAGGG - Intergenic
963669111 3:148229946-148229968 CTGGTGTCCTTATTAAAAAGAGG - Intergenic
963742308 3:149092800-149092822 CTCTTGTCAAAAAAAAAAAAAGG - Intergenic
963785864 3:149533750-149533772 TTGTTCACCTGAAAAAAAAAAGG + Intronic
964225952 3:154402202-154402224 CTGATGTCCTTAAAGCAAATGGG + Intronic
964333440 3:155629182-155629204 CTGATGTCATTCAGAAAAAATGG - Intronic
964471419 3:157060855-157060877 CTGATGTCCTTATAAGAAGAAGG + Intergenic
964493341 3:157260993-157261015 TTGTTGTCCTTTAAGAAGAAGGG - Exonic
964526930 3:157625022-157625044 CTGGTGTCCTTATAAGAGAAAGG + Intronic
964818828 3:160747531-160747553 TAGTTGTTCTTAAAAGAAAAAGG + Intergenic
965044437 3:163557490-163557512 CTGGTGGCCTTAAGAAAAACGGG - Intergenic
965283915 3:166791682-166791704 CTATTCAGCTTAAAAAAAAAAGG - Intergenic
965859008 3:173124591-173124613 TTGTTTTTCTTAAAAGAAAAGGG - Intronic
966342843 3:178944713-178944735 TTGTTGTCTTTAAGAAAACAAGG - Intergenic
967360630 3:188626655-188626677 GAGTTGTCCTTATAAAAAGAGGG - Intronic
967744871 3:193043860-193043882 CTGGTGTCCTTATAAGAAAAGGG - Intergenic
968261537 3:197328835-197328857 ATGTTACCTTTAAAAAAAAAAGG + Intergenic
969220884 4:5757687-5757709 CTGGTGTCCTTATAAGAAAAGGG - Intronic
969381179 4:6799225-6799247 CTGATGTCCTTATAAGAAGAGGG - Intronic
969408590 4:7012676-7012698 CTGTTGTATTTAACAATAAAAGG + Intronic
969488027 4:7483013-7483035 CTGATGTCCTTATGAAAAAAAGG + Intronic
970015114 4:11504476-11504498 CTGGTATCCTTACAAAAGAAAGG + Intergenic
970018588 4:11540729-11540751 CTGATGAACTAAAAAAAAAAAGG + Intergenic
970053170 4:11939318-11939340 CTGATGTCCTTATAAGAAAAGGG + Intergenic
970076858 4:12232011-12232033 CTGTGGTTCAGAAAAAAAAAAGG + Intergenic
970213897 4:13738700-13738722 CAGTTGTTCTTTAAAAGAAATGG + Intergenic
970448020 4:16140103-16140125 CTGTTGTACTTATCAGAAAAGGG + Intergenic
971030980 4:22636288-22636310 CTAGTGTCCTTATATAAAAATGG - Intergenic
971096775 4:23415070-23415092 TAGTTGACCTTAAGAAAAAAAGG - Intergenic
971287767 4:25306945-25306967 CTGGTGTCCTTATAAAAAAGAGG - Intergenic
971574205 4:28253396-28253418 CTGTTGTCCTTACAAAAAGGAGG - Intergenic
971742113 4:30534348-30534370 CAATTGACCTTAATAAAAAAAGG - Intergenic
972221632 4:36962610-36962632 CTGTTGTCTAAGAAAAAAAATGG + Intergenic
972554971 4:40172485-40172507 CTGGTGTCCTTATAAAAAGGAGG + Intergenic
972716201 4:41648733-41648755 CTGTTGTACTGGAAAAACAACGG - Intronic
972834783 4:42856778-42856800 CTGGTGTCCTCATTAAAAAAAGG + Intergenic
973200403 4:47495306-47495328 AAGTTGTGCTTTAAAAAAAAAGG + Intronic
973398855 4:49620506-49620528 AGGTTATCTTTAAAAAAAAATGG + Intergenic
973834053 4:54791615-54791637 CTGGTGTCCTTAAAAGGAAGAGG - Intergenic
973967806 4:56181802-56181824 CTGGTGTCCTTATAAGAAGAGGG - Intronic
974582686 4:63825605-63825627 CTGTTGTAGTCAAAATAAAATGG - Intergenic
974641562 4:64639456-64639478 CTGTTTTCCATTAAGAAAAAGGG + Intergenic
976128893 4:81863094-81863116 CTTTTGTCCATTAAAAAAATTGG - Intronic
976196562 4:82537707-82537729 CTGATGTCCTTATAAAAAAGAGG + Intronic
976311801 4:83620542-83620564 CTGGTGTTCTTGTAAAAAAAAGG - Intergenic
976325281 4:83763932-83763954 CTGTTGTACAGAAAAATAAATGG + Intergenic
976758686 4:88525016-88525038 CTGTTTTTTTTAAAAAAAACAGG - Intronic
976831962 4:89325325-89325347 CTGTTTTTCTTAACAAATAAAGG - Intergenic
976882581 4:89946902-89946924 CTGATCTCCATTAAAAAAAATGG + Intronic
977211683 4:94225364-94225386 CTGATGTCCTTATAAGAAAAGGG - Intronic
977269854 4:94903744-94903766 CTGGTGTCCTTATAAGAAGAAGG + Intronic
977432881 4:96954407-96954429 TTGTTGTCCATAATAAAATATGG - Intergenic
977521412 4:98089053-98089075 CTATTGAAATTAAAAAAAAATGG - Intronic
978227894 4:106360700-106360722 TTGGTGTCCTTATAAAAAAAGGG + Intergenic
978545025 4:109861753-109861775 CTGGTGTCTTTAGTAAAAAAAGG + Intronic
978776396 4:112510461-112510483 CTTTTATTCTTAAAAAAAATGGG - Intergenic
978870584 4:113572064-113572086 CAGTTTTCATAAAAAAAAAAAGG + Intronic
979564302 4:122136865-122136887 CTGTTGTACTTAAAAAGAGTTGG - Intergenic
979611365 4:122692228-122692250 CTGATGTCCTTATGAGAAAATGG + Intergenic
979757523 4:124360722-124360744 CTCTTTTCCTAAAAAAAAAAAGG + Intergenic
979809954 4:125025035-125025057 TTCTTGTTATTAAAAAAAAATGG + Intergenic
979838504 4:125405515-125405537 CTCTTGTCTCAAAAAAAAAAAGG - Intronic
979989782 4:127362132-127362154 CTGTTTTCTTGAAATAAAAAGGG - Intergenic
980286060 4:130779771-130779793 CTGTTGCCCTTAAAACAGAGGGG - Intergenic
980372754 4:131899111-131899133 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
980630213 4:135421753-135421775 CTTGTTTCCTTAAAAATAAAAGG + Intergenic
980760767 4:137231054-137231076 CTAGTGTCATTAAAAGAAAAGGG + Intergenic
980953924 4:139409223-139409245 CTGATGTCCTTAAACATGAAAGG - Intronic
982041349 4:151399860-151399882 CTACTTTCCTTTAAAAAAAATGG + Intergenic
982196991 4:152926489-152926511 CTGATGTGATGAAAAAAAAAGGG + Intergenic
982233599 4:153231797-153231819 CTGATGTCCTTACAAAAAGGGGG - Intronic
982385359 4:154795353-154795375 CTAATTTCCTTAAAATAAAAAGG - Intronic
982418713 4:155167931-155167953 CTGTTGTGCAGAAAAAAAAATGG + Intergenic
982591291 4:157315415-157315437 CTGTTGTCTTGAAAAAACACTGG - Intronic
983050080 4:163035905-163035927 TATTTGTCCTTAAAAACAAATGG + Intergenic
983680951 4:170352921-170352943 CTGTTGTCTTTAAAAATATCAGG - Intergenic
983738920 4:171102900-171102922 CTGTTGTCCTTGAATCTAAAGGG - Intergenic
984088458 4:175341002-175341024 CTGTTTTCTTCAAGAAAAAAAGG + Intergenic
984115049 4:175669823-175669845 CTGCTGTCCTTATAAAAAAAGGG + Intronic
984312074 4:178074496-178074518 CTGGTGACCTTATAAAAAGAAGG - Intergenic
984869892 4:184316605-184316627 CTATTGTCCTTGTAAGAAAAGGG - Intergenic
984928708 4:184827721-184827743 CTGGTGTCCTTATAGAAAGAAGG - Intergenic
984962028 4:185107030-185107052 CTGTTGGCATTAAGAATAAAAGG - Intergenic
985077335 4:186229014-186229036 CTTTTTTCCTGGAAAAAAAAAGG - Intronic
986315729 5:6585149-6585171 CTGGTGTCCCTACAGAAAAAGGG + Intergenic
986708902 5:10473324-10473346 CTGGTGCCCTTAAAAGAGAAAGG + Intergenic
986972814 5:13356974-13356996 CTGTTGTCCTTATAAGAAGAGGG + Intergenic
987585541 5:19851187-19851209 CTGTGGTCCTATAAAAATAAAGG + Intronic
987789861 5:22551150-22551172 CTGGTGTCCTTATAAGAAAAGGG + Intronic
987854885 5:23407888-23407910 ATCTTTTCCTTAAAAAAAAGTGG - Intergenic
987895073 5:23934066-23934088 CTGATGTCCTTATAGGAAAAAGG + Intergenic
988589094 5:32533521-32533543 CAGTCCTCCTTTAAAAAAAAAGG + Intronic
989724336 5:44570250-44570272 CTGGTGTCCTTATAAGAGAAAGG - Intergenic
990314369 5:54570125-54570147 CTGGTGTCCTTATAAGAAGAGGG + Intergenic
990597171 5:57323434-57323456 CTGGTATCCTTAAAAAAAGGGGG + Intergenic
990803251 5:59629370-59629392 CTGGTGTCCTTGTAATAAAAGGG + Intronic
990819672 5:59823791-59823813 TTGTTATCTTAAAAAAAAAATGG - Intronic
990980394 5:61597848-61597870 CTGGTGTCCTTATAAGAAGAAGG - Intergenic
990998328 5:61756113-61756135 TGGTTGTACTTAATAAAAAATGG - Intergenic
991152143 5:63382918-63382940 CTGTTGTTCTTATAAAAAGGGGG + Intergenic
991905561 5:71506825-71506847 CCCTTGTCTTTAAAAAAATATGG - Intronic
992352754 5:75947890-75947912 CTCTTGATTTTAAAAAAAAATGG - Intergenic
992571517 5:78064067-78064089 CAGTGGACATTAAAAAAAAAAGG + Intronic
992636725 5:78731663-78731685 CTGGTGTCCTTATAAAATAAAGG - Intronic
993037345 5:82772106-82772128 CTGTTTTCCCTATAAAATAAGGG + Intergenic
993240006 5:85370219-85370241 ATGTTGTCCTTATAAAAAGTGGG + Intergenic
993523161 5:88930222-88930244 CAGATGTCCAAAAAAAAAAAAGG - Intergenic
993542510 5:89169892-89169914 CTTTTGCCTTTAAAAAAAAAAGG + Intergenic
993626515 5:90231544-90231566 AGGTTGTCCTAAAAATAAAATGG + Intergenic
993954423 5:94215034-94215056 CTCTTGTCTTTAAAAAAACTTGG - Intronic
994019717 5:95008728-95008750 CTGGTGTCCTTAAAAGAGAAAGG + Intronic
994155236 5:96495940-96495962 TTATTGTCCTGAAAAAGAAAAGG + Intergenic
994399507 5:99261955-99261977 CTCTTGTCACTAAACAAAAATGG - Intergenic
994439132 5:99779946-99779968 CTGTTGTCCTTGAACAAGCAAGG - Intergenic
994613244 5:102072587-102072609 CTCTTCTGCTTAAAAGAAAAGGG - Intergenic
994920850 5:106040934-106040956 CTGGTGTCCTTATAACAAGAGGG - Intergenic
994946685 5:106402894-106402916 CTGTTGTCATTGATATAAAAAGG + Intergenic
995292009 5:110467995-110468017 CTGGTGTCCTTATAAAAAGTGGG - Intronic
995705373 5:114983475-114983497 CTGTTTTCCTGAACAAAGAAAGG - Intergenic
996290280 5:121844571-121844593 CTGATGTCCTTATAAGAAGAGGG - Intergenic
996388056 5:122929439-122929461 ACGTTGTCTCTAAAAAAAAAAGG - Intronic
996915462 5:128707103-128707125 CTGGTGTCTTTATAAAAGAAAGG - Intronic
997857448 5:137384789-137384811 TAGTTGTCCTTAAAAGAGAAAGG - Intronic
997936395 5:138115049-138115071 TTTTTGTCATTAAAAAACAATGG - Intergenic
998194023 5:140051035-140051057 CTGCTTTATTTAAAAAAAAAAGG + Intergenic
998700978 5:144699490-144699512 CTTTTGTCCTAATAATAAAAGGG + Intergenic
999155185 5:149452811-149452833 CTGGTGTCCTTACAAAAAGAGGG + Intergenic
999161033 5:149499286-149499308 CTTTATTCCTTAAAAAAAAAGGG + Intronic
999459666 5:151747035-151747057 CTTTTGCAATTAAAAAAAAAAGG - Intronic
1000292927 5:159888030-159888052 CTTTTCTCCTGAAAAATAAATGG - Intergenic
1000753133 5:165121985-165122007 CTGCTTTCCTTTAAAAACAAAGG - Intergenic
1000865160 5:166504619-166504641 CTGGTGTTCTTATAAAAGAAAGG - Intergenic
1001050171 5:168407867-168407889 CCCTGGTTCTTAAAAAAAAAAGG - Intronic
1001105145 5:168846800-168846822 CTGGTGTTCTCAAAAAGAAAAGG - Intronic
1001312612 5:170622311-170622333 CTGATGTCCTTATAAAAAGAAGG + Intronic
1001427969 5:171636804-171636826 CAGGTGTCCTTATAAGAAAAAGG + Intergenic
1001720271 5:173851453-173851475 CTGTGGCCATTAAGAAAAAAAGG + Intergenic
1002352278 5:178591398-178591420 TTATTTTTCTTAAAAAAAAATGG - Intergenic
1002459289 5:179364963-179364985 CTCTTGTCCTTATAAAAGAGGGG - Intergenic
1002781377 6:369445-369467 CTATTGTCCTTAGAAAGAAGAGG + Intergenic
1002993372 6:2258557-2258579 CTGTTGTCCCTATTAAAAGAGGG - Intergenic
1003617499 6:7668833-7668855 CTGGTGTCCTTACAACAAGAGGG + Intergenic
1003870338 6:10398073-10398095 TTGTTTTGTTTAAAAAAAAAAGG + Exonic
1003875755 6:10434825-10434847 CTGGTGTCCTTACAAGAAGAGGG - Intergenic
1003918024 6:10805873-10805895 CTGATGTCCTTATAAAAAGAAGG - Intronic
1004165176 6:13250599-13250621 ATGTTGTCCTTAAGAAAGGAAGG + Intronic
1004288271 6:14343061-14343083 TTGGTGTCCTTATAAAAAAAGGG + Intergenic
1004419609 6:15456846-15456868 CTGTTTTTCTTAAATTAAAATGG - Intronic
1004963208 6:20816132-20816154 CTGTTGTCCTTAAAAAAAAAAGG - Intronic
1005004015 6:21270189-21270211 CAGGTGTCCTTATAAAAGAAAGG - Intergenic
1006150682 6:31986216-31986238 ATATTATCTTTAAAAAAAAAAGG - Intronic
1006156983 6:32018954-32018976 ATATTATCTTTAAAAAAAAAAGG - Intronic
1006524217 6:34589975-34589997 CTGATGCCATTAAAAACAAATGG + Exonic
1007389874 6:41545089-41545111 CAGTGGTCCTTGAAAGAAAAGGG - Intergenic
1007405375 6:41632790-41632812 CTGGTGTCCTTACAAAAATTTGG + Intergenic
1007430941 6:41776614-41776636 TTGTTTTCTCTAAAAAAAAAAGG + Intronic
1007837126 6:44682370-44682392 CTGGTTTCCTAGAAAAAAAAGGG + Intergenic
1007960923 6:45958131-45958153 CTGATGTCCTTACAAGAAGAGGG + Intronic
1009472402 6:64043891-64043913 CTGTTCCCCTTAAAATATAAAGG + Intronic
1009517543 6:64639164-64639186 CTGGTGTCCTTATAAAAAAGAGG - Intronic
1009749223 6:67861663-67861685 CTGTCTTGGTTAAAAAAAAAAGG + Intergenic
1009850867 6:69196550-69196572 CTGGTGTCCTTATAGAAAAAAGG - Intronic
1009921695 6:70069704-70069726 CAGTTTTCATTAAAATAAAAAGG - Intronic
1010394488 6:75375053-75375075 CTATTGTCCTTCAACCAAAATGG - Intronic
1010595531 6:77758425-77758447 CTCTTGTCCTTCAGAAAAAAAGG - Intronic
1011010602 6:82699466-82699488 CTGTTATCCTTAGAAATGAATGG + Intergenic
1011131207 6:84053325-84053347 TTATTTTCCTTAATAAAAAAAGG + Intronic
1011252254 6:85384317-85384339 CAGTTGGGCTCAAAAAAAAAAGG + Intergenic
1011553223 6:88548675-88548697 CTGGTGTCCTTATAAGAGAAAGG - Intergenic
1011841263 6:91502211-91502233 TTGTTGTGCTTACAAAATAAAGG + Intergenic
1012197092 6:96356731-96356753 CTGTTGTCCTCCAAGAAATACGG - Intergenic
1012522875 6:100141777-100141799 CTGGTGTCCTTATAAGAAGAGGG + Intergenic
1012769362 6:103409642-103409664 CTGATGTCTTTATAAAAGAAAGG + Intergenic
1013182438 6:107729406-107729428 CTGGTGTCCTTAGAAGAAGAAGG - Intronic
1013459378 6:110359976-110359998 ATGTTGTCATGAAAAACAAAAGG + Intergenic
1013466587 6:110422675-110422697 CTGATGGCCTTAAAAGAAGAAGG + Intergenic
1013586779 6:111586234-111586256 CTGTGGACCAAAAAAAAAAAAGG - Intronic
1013856306 6:114577371-114577393 CAGTTGGCCTTAGAAACAAAAGG + Intergenic
1014303414 6:119711740-119711762 CTGGTGTCCTTATAAGAAGATGG - Intergenic
1014539981 6:122663683-122663705 CTGGTGTCCTTATAAAAGGAGGG - Intronic
1014784192 6:125599097-125599119 CTGCTGTCCTTATAAGAAGATGG + Intergenic
1014801120 6:125779016-125779038 AATTTCTCCTTAAAAAAAAAAGG + Intergenic
1014860390 6:126459918-126459940 AGGCTTTCCTTAAAAAAAAAAGG - Intergenic
1014944674 6:127482965-127482987 CAGTTATCCTTAAAAAGAAGAGG - Exonic
1015073847 6:129131025-129131047 TTTTTGTCCTTAATAGAAAAGGG + Intronic
1015290657 6:131535173-131535195 CTAGTGTCCTTACAAAAAAAAGG + Intergenic
1015312959 6:131784810-131784832 CTGCTGTCCTTATAAAAGAAGGG - Intergenic
1015356983 6:132289596-132289618 CTGTTAAGCATAAAAAAAAAAGG + Intergenic
1015658737 6:135548830-135548852 CTGGTGTCTATAGAAAAAAATGG - Intergenic
1015772850 6:136786725-136786747 CTGATGTCTTTAAAAAGAATAGG - Intronic
1015841013 6:137477309-137477331 CTGGTGTCCTTAAAACAAGAGGG + Intergenic
1016189165 6:141239655-141239677 CTGTTATCCATGAGAAAAAATGG + Intergenic
1016397648 6:143642652-143642674 CTGGTGTTCTTATAAAAAGAGGG + Intronic
1016519411 6:144929787-144929809 CTGGTGTCCTTATAAGAAGAAGG + Intergenic
1016674544 6:146748888-146748910 TTGGTGTCCTCATAAAAAAAGGG - Intronic
1017139846 6:151180526-151180548 CTGGTGTCCTTATAAAAAAGAGG - Intergenic
1017173664 6:151481430-151481452 CTGTTGACCTTGTAAACAAAGGG - Intergenic
1018062808 6:160103731-160103753 CTGTTTCCCTATAAAAAAAAAGG - Exonic
1018390007 6:163335087-163335109 CTGGTGTCCTTATAGAAAGAAGG + Intergenic
1018566550 6:165161154-165161176 GTGATGTCCTTATAAGAAAATGG + Intergenic
1018598594 6:165512980-165513002 CTGTTGACTTTTAAAAAAATGGG + Intronic
1019973452 7:4561103-4561125 CTGATGACCTTATAAAAAGAGGG + Intergenic
1020396156 7:7720971-7720993 CTGATGTCCTTATAAGAAGAGGG + Intronic
1020405294 7:7826189-7826211 CTGGTGGCCTTAACAAAACAGGG + Intronic
1020553115 7:9632920-9632942 ATGTTCTCATTATAAAAAAATGG + Intergenic
1020950805 7:14674663-14674685 CTGGTGTCCTTATAAGAAGAGGG + Intronic
1021190123 7:17610603-17610625 CTGATGTACTTAAAAGAAGAGGG + Intergenic
1021926798 7:25541698-25541720 CTGTTTTCCTGACAAGAAAAAGG + Intergenic
1022137494 7:27462856-27462878 CTGATGGCCTTAAAAGAACATGG + Intergenic
1022623583 7:32010818-32010840 CTGGTGTCCTTATAAAAAGGAGG - Intronic
1023202394 7:37712582-37712604 CAGGTGTGCTTAAAAACAAAAGG - Intronic
1023463164 7:40422632-40422654 GTGTTGTCCTTAAATAAAGTAGG + Intronic
1023895814 7:44431977-44431999 CTGTGGTTTTTAAAAACAAATGG - Intronic
1024282516 7:47731301-47731323 CTGGTGTCCTTATAAGAAGAGGG + Intronic
1024347638 7:48329509-48329531 CTGTTGCCCCTGAAACAAAAGGG - Intronic
1024535011 7:50423194-50423216 CTGGTGTCCTTATAGGAAAAGGG + Intergenic
1024538072 7:50454739-50454761 TTGGTGTCCTTATAAAGAAAAGG + Intronic
1024878540 7:54056539-54056561 CTGTTTTCCTTTGAGAAAAATGG - Intergenic
1025320628 7:58089581-58089603 CTGATGAGCTTAAAAAAAAAAGG + Intergenic
1026644334 7:72154733-72154755 CTGGTGTCCTTAATAAGAAGAGG + Intronic
1026673679 7:72411499-72411521 TTTTTGTCTTTAAAAAAATATGG + Intronic
1027421438 7:78020562-78020584 CTGATGGGCTCAAAAAAAAAAGG + Intronic
1028817380 7:95162277-95162299 CTGTTTTCCTTAAAAAGATTTGG - Intronic
1028901499 7:96106024-96106046 ATGTTTTCTTTAAAAATAAAAGG + Intronic
1029175111 7:98659096-98659118 CAGTTGTCATGGAAAAAAAATGG + Intergenic
1029256306 7:99272003-99272025 CTGGTGTCCATATAAAAAGAGGG - Intergenic
1029334868 7:99890022-99890044 CTGGTGTCCTTATAAAAAGAAGG - Intronic
1029805727 7:102994315-102994337 GTCCTGTCCTTAAAAAAACAAGG - Intronic
1030105797 7:105986133-105986155 TTGTTTTCCTGATAAAAAAAGGG - Intronic
1030413934 7:109215928-109215950 CTGGTGTCCTTACATAGAAAGGG + Intergenic
1030695890 7:112584745-112584767 CTTTTGTCCTTAGAAAAGAAAGG - Intergenic
1031029113 7:116715433-116715455 CTGTTGTCCTTATAAGAAGAGGG - Intronic
1031225697 7:119035220-119035242 CTTTTTTCCTTAAAAAAAAAAGG - Intergenic
1031328286 7:120430278-120430300 CTGGTGTCCTTATAAGAAGAAGG - Intronic
1031478352 7:122249266-122249288 CTGATGTCCTTTTAAAAAGAGGG + Intergenic
1031621184 7:123936059-123936081 CTGTTGTGCTTAAAATGAATTGG + Intronic
1032457704 7:132086387-132086409 TTTTTTTCCTTAAAAAAAAGAGG - Intergenic
1032854621 7:135824175-135824197 TTTTCTTCCTTAAAAAAAAAAGG + Intergenic
1032882407 7:136103512-136103534 CTGTTCTCATGAAAATAAAAAGG - Intergenic
1032990804 7:137393223-137393245 CTGCTTTTTTTAAAAAAAAATGG - Intronic
1033069106 7:138185740-138185762 CTGGTGTTCTTATAAAAAGAAGG - Intergenic
1033313377 7:140278702-140278724 CTGTTGTCTTTATAAGAGAAAGG - Intergenic
1033992377 7:147304510-147304532 TTGTTATCATTAAAAGAAAAAGG + Intronic
1034980612 7:155473737-155473759 CTGGTGTCCTTATAAGCAAAGGG - Intergenic
1035842889 8:2831714-2831736 CTCTTGTCTTTAAGAAAAACTGG + Intergenic
1036382693 8:8247904-8247926 CTGTTACCCTTAAAAATGAAGGG + Intergenic
1036452825 8:8883395-8883417 CAGGTGTCCTTAATCAAAAAGGG + Intronic
1036515515 8:9440030-9440052 CTGGTGTCCTTATAAAACGAGGG - Intergenic
1036985785 8:13529127-13529149 ATGTTTTTCTTAAAATAAAATGG + Intergenic
1037610285 8:20470254-20470276 CTGGTATCCTTAAAAAAGAGGGG - Intergenic
1038113491 8:24526251-24526273 CAGTTGTCCTTAAGGGAAAAAGG - Intronic
1038158200 8:25011111-25011133 TTCTTGTCCTCAAAAGAAAAAGG + Intergenic
1038165524 8:25081773-25081795 CTTCTGTCCTTATAAAAAGAGGG - Intergenic
1038783383 8:30588382-30588404 CTATTAGCCTTAAAAAAGAAAGG + Intronic
1039370893 8:36982889-36982911 CTGATGTCCTTACAAGAAGAGGG + Intergenic
1040010435 8:42656980-42657002 CTGGTGTCCTTACAAAAATGAGG - Intergenic
1040899102 8:52399773-52399795 CTGTTGTGGTTGGAAAAAAATGG + Intronic
1041119522 8:54571874-54571896 CTGGTGTCCTTACAAAAAAAGGG - Intergenic
1041204964 8:55489587-55489609 CTTTTGTTATTTAAAAAAAAAGG + Intronic
1041398791 8:57419418-57419440 CCCTTCTCCTTAAAAAAAAGAGG + Intergenic
1041602657 8:59738504-59738526 ATGTACTCCTTAAAAAGAAAGGG + Intergenic
1041608505 8:59815034-59815056 CTGGTGTTCTTATAAAAGAAAGG - Intergenic
1041969706 8:63725221-63725243 CATATGTCCTTAAAAAATAAAGG + Intergenic
1042000059 8:64112061-64112083 CTGGTGTCCTTATAAGAAGAGGG - Intergenic
1042092945 8:65178819-65178841 CTGTTGCCCTTATAAAAAGGGGG - Intergenic
1042208428 8:66352421-66352443 CTGCTGTCCTTAACAAAGAGAGG - Intergenic
1042703077 8:71637826-71637848 GTGTTGTCTTGAAAAAAGAATGG + Intergenic
1042793172 8:72631490-72631512 CTGATGTTCTTATAAAAAAGGGG - Intronic
1043079650 8:75750111-75750133 CAGTAATTCTTAAAAAAAAAAGG - Intergenic
1043473785 8:80586440-80586462 CTATTTTATTTAAAAAAAAAAGG - Intergenic
1043521653 8:81052824-81052846 CTGTTGTTCTTGGAAAACAAAGG + Intronic
1043693063 8:83181600-83181622 CTGTTGTCTTTAATAATAAGGGG + Intergenic
1044306022 8:90642414-90642436 TTTTTTTCTTTAAAAAAAAAAGG + Intronic
1044586829 8:93876170-93876192 CTGTTGTCTTTATAAAAGGAAGG - Intronic
1044678488 8:94753517-94753539 CTGTTGTGCTAAACAGAAAATGG + Intronic
1044771969 8:95645662-95645684 CTGGTGTCCTTATAAGAAGAGGG - Intergenic
1044963311 8:97552212-97552234 CTGATGTCTTTATAAAAAGAGGG - Intergenic
1045128494 8:99121729-99121751 ATATTGTCATTAAAAAAGAAAGG + Intronic
1045172683 8:99687834-99687856 CAATTATCCATAAAAAAAAAAGG - Intronic
1045369840 8:101512151-101512173 CAGTTTGCATTAAAAAAAAAAGG - Intronic
1045550800 8:103170465-103170487 CTGTTGTTCTTGTAAGAAAAAGG + Intronic
1045719240 8:105088068-105088090 ATGTTGACCTTAGAAAAATAGGG - Intronic
1045723837 8:105147064-105147086 AAGTTGTGCTTGAAAAAAAAGGG + Intronic
1045797410 8:106062150-106062172 CTGGTGTCCTTATAAGGAAAGGG + Intergenic
1046082787 8:109392500-109392522 CTGTTGGCTTTAAAAAAAAATGG - Intronic
1046097978 8:109582822-109582844 CTGGTGTCCTTATACAAAGAAGG + Intronic
1046183721 8:110685897-110685919 TTGTTCTCATTTAAAAAAAAAGG - Intergenic
1046391853 8:113584322-113584344 TTGATTTCTTTAAAAAAAAATGG - Intergenic
1046746090 8:117877547-117877569 CTGATCTCTTTAAAATAAAATGG - Intronic
1046839393 8:118840598-118840620 CTGCTGTCCTTATAAAAAGGAGG + Intergenic
1047080642 8:121455973-121455995 CTGTTGTTCTAAAAATAAAGAGG + Intergenic
1047124067 8:121940713-121940735 CTCCTTTCCATAAAAAAAAAAGG + Intergenic
1047810789 8:128406495-128406517 CTGTAGTAGATAAAAAAAAATGG - Intergenic
1047851418 8:128861567-128861589 CTGTTTTCCTCAACATAAAAGGG + Intergenic
1048358015 8:133669418-133669440 CTGCTCCTCTTAAAAAAAAATGG + Intergenic
1048421055 8:134278860-134278882 CTGCTGTCCTTAAAAGAAGAGGG + Intergenic
1048424816 8:134313199-134313221 TTGTTTTCCTTAAAATAAAGAGG + Intergenic
1048490792 8:134891759-134891781 CTGTTTTCCTTTAAGTAAAAAGG - Intergenic
1048748129 8:137638258-137638280 GTGTTTTCTTTAGAAAAAAAAGG - Intergenic
1049133334 8:140869578-140869600 TTTTTTTGCTTAAAAAAAAAAGG - Intronic
1049183589 8:141236599-141236621 ATTTTGTCATTTAAAAAAAACGG - Intronic
1049449284 8:142650798-142650820 CAGTCTTCCTTAAAAAACAAGGG + Intergenic
1049900307 9:155779-155801 CTGTTTTCCTTATGAAAATATGG - Intronic
1049957462 9:706995-707017 CTGTTTTCATTAAGAAAACAGGG + Intronic
1050161163 9:2719470-2719492 CTTGTCCCCTTAAAAAAAAATGG - Intronic
1050291727 9:4162214-4162236 TTGATGTTCTTAAAAAAAGAAGG - Intronic
1051319840 9:15890682-15890704 AATTTGTCCTTAAAACAAAATGG + Intronic
1051526325 9:18049095-18049117 CTGGTGTCCTTATAAGAGAAAGG - Intergenic
1051877887 9:21810287-21810309 CTGTTGTCCTTACAAGAGATTGG - Intronic
1052104912 9:24501663-24501685 CTGATTTCCTGAAAAAAAAATGG + Intergenic
1052222966 9:26049864-26049886 CTGATGTCCTTAAAAGGAGAGGG - Intergenic
1053529465 9:38865451-38865473 CTGTTTAACTGAAAAAAAAATGG + Intergenic
1053637542 9:40027154-40027176 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
1053768539 9:41438085-41438107 CTGTTGTTGTTAAGAAAATAAGG + Intergenic
1054337616 9:63820845-63820867 CTGCAGTTCTTAAAACAAAACGG + Intergenic
1054547207 9:66349566-66349588 CTGTTGTTGTTAAGAAAATAAGG + Intergenic
1055240139 9:74173969-74173991 CTGTTGTATTTAAGAAAAAATGG + Intergenic
1055282316 9:74688970-74688992 TTGTGGTCCATAAAAAGAAAGGG + Exonic
1055561546 9:77526485-77526507 CTGGTGTCCTTGTAAGAAAAGGG + Intronic
1055807124 9:80108325-80108347 TTGTTGTTCAAAAAAAAAAAGGG + Intergenic
1055918093 9:81427556-81427578 ATGTTGTCCTTATAAGAAGATGG - Intergenic
1056718552 9:89054032-89054054 ATTTTCTCCTTAAAAAAAACAGG - Intronic
1057480469 9:95441357-95441379 CTGTTGTGCCAAAAAAAAAATGG + Intergenic
1058952038 9:109913065-109913087 ATGTTGTTCCTAAAAGAAAAGGG + Intronic
1060049713 9:120369553-120369575 CCCTTTTGCTTAAAAAAAAAAGG + Intergenic
1060721344 9:125981489-125981511 ATGTATTTCTTAAAAAAAAAAGG - Intergenic
1062007749 9:134249842-134249864 CTGGTGTCTTTAAAAGAAGAGGG + Intergenic
1202785351 9_KI270719v1_random:10397-10419 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
1186158917 X:6755929-6755951 ATGTTGTCCTGAAAACCAAAGGG + Intergenic
1186271000 X:7887988-7888010 CTGTTGTCTTTCAGAATAAAAGG - Intergenic
1186409742 X:9336326-9336348 CTGGTGTCCTTATAAGAGAAAGG + Intergenic
1186530536 X:10290696-10290718 ATGTTGACCTTAAAAAAGTAGGG - Intergenic
1186997989 X:15144075-15144097 CAGATGTCCTTAAGAAAACAAGG - Intergenic
1187239183 X:17496924-17496946 CTGATGCCCTTAAACTAAAATGG + Intronic
1187561762 X:20410029-20410051 TTATTGGCTTTAAAAAAAAAAGG + Intergenic
1187599897 X:20817100-20817122 CTGTTGTCATAAAAAGAGAAAGG + Intergenic
1187811252 X:23179832-23179854 CTGCTGTCATTAAAAACAAGTGG + Intergenic
1188037511 X:25335160-25335182 TCTTTGTTCTTAAAAAAAAAAGG + Intergenic
1188303978 X:28539764-28539786 CTGATGTCCTTAAAAGAAGAGGG + Intergenic
1188821027 X:34775263-34775285 GAGTTTTACTTAAAAAAAAATGG + Intergenic
1189173111 X:38928374-38928396 CTTTTGTCCATAAAAAAAAATGG - Intergenic
1189295407 X:39914203-39914225 CTGTTGTCCTCATAAGAAGAGGG + Intergenic
1189614048 X:42766251-42766273 CCCTTGTCCTAAAACAAAAAGGG + Intergenic
1190430549 X:50374224-50374246 CTGGTGTCCTTATAAGAAGATGG + Intronic
1190431671 X:50383794-50383816 CTGTTGCCCTTAACAGTAAATGG - Intronic
1190872552 X:54436795-54436817 CTGATGTCCTTATAAAGAAGGGG - Intergenic
1191026399 X:55918780-55918802 CTGGTGTCCTTATAAAGAAGAGG - Intergenic
1191058624 X:56270798-56270820 TTGTTCACATTAAAAAAAAAAGG + Intronic
1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG + Intronic
1191875471 X:65790570-65790592 CTTTTGTCCTTCAAAAATATAGG - Intergenic
1191939372 X:66461828-66461850 CTGTTTTCCTTGAAAATACATGG - Intergenic
1191953856 X:66623327-66623349 CTATTCTCCCTAGAAAAAAATGG - Intronic
1192585057 X:72312829-72312851 CTTCTGTGTTTAAAAAAAAAGGG + Intergenic
1192986843 X:76408851-76408873 CTGTAGGCCTAAATAAAAAAGGG - Intergenic
1193359610 X:80565217-80565239 ATGGTTTCCTTAAAAAAAAATGG + Intergenic
1193380707 X:80813166-80813188 CTGGTGTCCTTATAAGAAAAAGG - Intergenic
1193576582 X:83205973-83205995 CTGTTGCTCTTAAAAATTAAAGG - Intergenic
1194305884 X:92247708-92247730 CTGACGTCCTTATAAGAAAAAGG - Intronic
1195096957 X:101511918-101511940 AAGTTGTACTAAAAAAAAAAAGG - Intronic
1195331839 X:103809112-103809134 TTGGTGTCCTTATAAGAAAAGGG + Intergenic
1195377797 X:104244573-104244595 CTGTTGTGCTTCACAAACAAGGG - Intergenic
1195740089 X:108056075-108056097 CTGTTGTCCTTATAAGAAAACGG - Intronic
1195937022 X:110135228-110135250 CTTTTCTTCTAAAAAAAAAAAGG + Intronic
1196090373 X:111734714-111734736 TAGTTTTGCTTAAAAAAAAAAGG - Intronic
1196618030 X:117790023-117790045 CTGTTGTCCTTTCCATAAAAGGG + Intergenic
1197588277 X:128376710-128376732 ATCTTGTCCTTTAAAAATAAAGG + Intergenic
1198552828 X:137762581-137762603 CTCTTGTCCTATAAACAAAAAGG - Intergenic
1198982970 X:142420211-142420233 CTGTTATCCTTACAAAACCAAGG + Intergenic
1200742314 Y:6867721-6867743 CTGTTGCCCTTAAAATTAAGAGG + Intronic
1200753653 Y:6969810-6969832 CTGTGGATTTTAAAAAAAAAAGG + Intronic
1201261514 Y:12163182-12163204 CTGGTGTCCTAATAAAAAGATGG - Intergenic
1201973818 Y:19825583-19825605 CTGGTGACCTTAAAAGAAAATGG + Intergenic