ID: 1004963712

View in Genome Browser
Species Human (GRCh38)
Location 6:20822640-20822662
Sequence AGGTAAATGAATTATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004963700_1004963712 23 Left 1004963700 6:20822594-20822616 CCTGTAATCCGCATAATCCCCAT 0: 1
1: 3
2: 29
3: 79
4: 200
Right 1004963712 6:20822640-20822662 AGGTAAATGAATTATGAGGATGG No data
1004963704_1004963712 6 Left 1004963704 6:20822611-20822633 CCCCATGTGTCACGGGAGAGTCC 0: 1
1: 1
2: 192
3: 1035
4: 2275
Right 1004963712 6:20822640-20822662 AGGTAAATGAATTATGAGGATGG No data
1004963701_1004963712 15 Left 1004963701 6:20822602-20822624 CCGCATAATCCCCATGTGTCACG 0: 2
1: 199
2: 527
3: 756
4: 912
Right 1004963712 6:20822640-20822662 AGGTAAATGAATTATGAGGATGG No data
1004963705_1004963712 5 Left 1004963705 6:20822612-20822634 CCCATGTGTCACGGGAGAGTCCA 0: 1
1: 0
2: 142
3: 472
4: 1859
Right 1004963712 6:20822640-20822662 AGGTAAATGAATTATGAGGATGG No data
1004963706_1004963712 4 Left 1004963706 6:20822613-20822635 CCATGTGTCACGGGAGAGTCCAG 0: 1
1: 0
2: 136
3: 420
4: 1561
Right 1004963712 6:20822640-20822662 AGGTAAATGAATTATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004963712 Original CRISPR AGGTAAATGAATTATGAGGA TGG Intronic
No off target data available for this crispr