ID: 1004965848

View in Genome Browser
Species Human (GRCh38)
Location 6:20850208-20850230
Sequence AACCTAGTACTACAATTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004965848_1004965849 -7 Left 1004965848 6:20850208-20850230 CCAATAAATTGTAGTACTAGGTT 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1004965849 6:20850224-20850246 CTAGGTTTAAAGCCACTCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 96
1004965848_1004965851 -2 Left 1004965848 6:20850208-20850230 CCAATAAATTGTAGTACTAGGTT 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1004965851 6:20850229-20850251 TTTAAAGCCACTCTGTGGATGGG No data
1004965848_1004965853 24 Left 1004965848 6:20850208-20850230 CCAATAAATTGTAGTACTAGGTT 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1004965853 6:20850255-20850277 TAAATTTCCCATCCTTAAAGCGG No data
1004965848_1004965850 -3 Left 1004965848 6:20850208-20850230 CCAATAAATTGTAGTACTAGGTT 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1004965850 6:20850228-20850250 GTTTAAAGCCACTCTGTGGATGG 0: 1
1: 0
2: 1
3: 28
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004965848 Original CRISPR AACCTAGTACTACAATTTAT TGG (reversed) Intronic
901696212 1:11010108-11010130 AACCTGGGACAGCAATTTATGGG + Intergenic
904067184 1:27762421-27762443 AATTTAGTACTATAATTTTTTGG - Intronic
906070115 1:43010290-43010312 AACAAAGTACTACAAATTAAGGG + Intergenic
910635063 1:89398757-89398779 AACATAGTACTAGAAGTTCTAGG - Intergenic
911876678 1:103173626-103173648 AACCTAGTTCTAGAATTCCTAGG + Intergenic
912061916 1:105684801-105684823 AACCTGGTCCTATAATTTTTTGG + Intergenic
915377252 1:155407407-155407429 AACCCAGTAATTCAATTTCTAGG + Intronic
916220153 1:162435539-162435561 AACTTAATACTAAAATGTATTGG - Intergenic
916913375 1:169377220-169377242 AACCTACTTTTACAACTTATTGG - Intronic
917767648 1:178240214-178240236 AGCCTATTATTTCAATTTATTGG + Intronic
921977927 1:221222876-221222898 TACTTAGAACTGCAATTTATGGG + Intergenic
923737197 1:236621657-236621679 AAATTGGTACTATAATTTATAGG + Intergenic
1065900748 10:30205704-30205726 AACCTAGTGATCCCATTTATAGG + Intergenic
1066452940 10:35547971-35547993 AACCTCTTACTACAGCTTATTGG + Intronic
1073856459 10:107680787-107680809 AAACTCATACTAAAATTTATTGG + Intergenic
1074554223 10:114473646-114473668 AACATATTACTACATTTTACAGG + Intronic
1075978534 10:126717879-126717901 AACCAATTACCACAATTTAGTGG - Intergenic
1079288571 11:19164260-19164282 GACCTATTACCACATTTTATTGG - Intronic
1087809807 11:102598185-102598207 CACTTATTACTACAATCTATAGG - Intronic
1088050116 11:105502977-105502999 ATCCAAGTTCTACCATTTATAGG - Intergenic
1091527627 12:1319587-1319609 ATTTTAGTACTAAAATTTATGGG - Intronic
1093560254 12:20530323-20530345 AACATATTACTACAACTTATGGG + Intronic
1093605138 12:21079607-21079629 TACCCAGTAATACAATTAATGGG + Intronic
1093649691 12:21628443-21628465 TCCCTAGTAATAAAATTTATTGG + Intergenic
1094653929 12:32402656-32402678 AACCTAGCACTACCTTTTCTAGG + Intronic
1098007078 12:66008814-66008836 AATGTATTATTACAATTTATTGG + Intergenic
1098345199 12:69495319-69495341 AACCTATTGCTTCAAATTATTGG + Intronic
1098522877 12:71453421-71453443 AACCCAGGACTACAAATTCTGGG - Intronic
1099775651 12:87124666-87124688 AACCTGGAACTCCAAATTATGGG + Intergenic
1103777421 12:123376586-123376608 AAACTAGTTGTACAATATATTGG - Intergenic
1104872749 12:132012090-132012112 GACCTAGTACTAGAAACTATAGG - Intronic
1106311137 13:28555626-28555648 AATAGAGTACTATAATTTATAGG - Intergenic
1106603935 13:31210071-31210093 AACCTGGGACTAAGATTTATAGG - Intronic
1109046125 13:57413187-57413209 AACATAGTACTGAAATTTCTAGG + Intergenic
1109598285 13:64587295-64587317 AACTTAGAAATACATTTTATAGG + Intergenic
1110968468 13:81731012-81731034 TACCTAGGAATACAATTTACAGG - Intergenic
1114686280 14:24534796-24534818 ATCCTAGAAATACATTTTATTGG - Intergenic
1115635511 14:35287021-35287043 ACTCTAGTTCTATAATTTATGGG - Intronic
1116132374 14:40872608-40872630 AGCATAGTACTACAAGTTCTAGG + Intergenic
1116445835 14:45009870-45009892 AACCTAGTAATAGAATTGATAGG + Intronic
1116595579 14:46840018-46840040 AAATTAGTTATACAATTTATTGG - Intronic
1118283009 14:64446506-64446528 AACCAAGTACTACAAACTAAAGG - Intronic
1127037518 15:54934343-54934365 AACCTAATAATACAAATGATTGG - Intergenic
1136018316 16:27421301-27421323 AAACTAGTCCTAAAATTTATAGG - Intronic
1136595192 16:31244075-31244097 TATCTACAACTACAATTTATTGG - Intergenic
1137018822 16:35402152-35402174 GCCCTAGTACTCTAATTTATGGG - Intergenic
1139816008 16:69672937-69672959 AAGTTAATACTACAATTTGTTGG - Intronic
1144402141 17:14915951-14915973 AACCTAATCCTCAAATTTATAGG + Intergenic
1152902817 17:82954411-82954433 TACCTAGGAATACAACTTATAGG + Intronic
1156201473 18:34836982-34837004 AACTTTGTACTACAAGTTTTAGG - Intronic
1165930203 19:39352798-39352820 AACCCAGTAAAAGAATTTATGGG + Intronic
929331262 2:40683969-40683991 TACCTAGGAATACAATTTACAGG + Intergenic
934668338 2:96189993-96190015 AACCAAGTAATACATTTTACTGG - Intronic
937103588 2:119290274-119290296 TTCCTAGTACAACAATTGATAGG - Intergenic
938786844 2:134637446-134637468 AACCTAGAACTAGAATAAATGGG + Intronic
939837220 2:147145800-147145822 AAATTAGTTCTACAATTCATTGG - Intergenic
942336537 2:174893094-174893116 AACCTAGTACTGGAAGTTCTTGG + Intronic
943145355 2:184037053-184037075 GAAATAGTACTACAATTTATAGG + Intergenic
943240163 2:185373996-185374018 AGTCTATTACTTCAATTTATTGG - Intergenic
944384601 2:199150562-199150584 AACCTAATGCTACAACTTTTAGG + Intergenic
1169974386 20:11307045-11307067 TGACTAGTATTACAATTTATAGG + Intergenic
1170716067 20:18832138-18832160 AACCAAGTAACACAATTCATTGG + Intergenic
1174643878 20:52068967-52068989 AACCCAGTAATTCAATTTCTGGG + Intronic
1180967922 22:19800197-19800219 AACTTAGGACTGTAATTTATGGG - Intronic
1182410953 22:30185731-30185753 AACCTATAACTGAAATTTATAGG + Intergenic
949646657 3:6103030-6103052 TACATAGTACTAAAATTAATAGG - Intergenic
951740640 3:25918882-25918904 AACATAGTACTAGAAGTTCTAGG - Intergenic
953236101 3:41108836-41108858 AACTTAGTAACTCAATTTATAGG - Intergenic
955541691 3:59983450-59983472 AACTTTGTACTACAATATATTGG + Intronic
956772763 3:72540397-72540419 AAGTAAGTCCTACAATTTATAGG - Intergenic
958446440 3:94221411-94221433 TACATAGTACTAAAATGTATAGG + Intergenic
958907584 3:99959026-99959048 AACCTATTTCAATAATTTATCGG - Intronic
959410503 3:106015411-106015433 TACCTAGTAGTACAATTGCTGGG - Intergenic
960070199 3:113421468-113421490 AACCTAGTAATCCAATTACTGGG + Intronic
960883647 3:122372131-122372153 AAACTAGTAGTACACTTTATTGG - Intronic
966026519 3:175290177-175290199 AACCCAGGACTAGAAATTATAGG - Intronic
966099394 3:176248411-176248433 AACCTAGTATTATAATGTCTTGG + Intergenic
967648752 3:191959417-191959439 AAACTAGTACTACAATTATGAGG - Intergenic
972797583 4:42437391-42437413 ACACCAGTACAACAATTTATGGG - Intronic
972812387 4:42604655-42604677 CACCTAGTAGTAGAATTTCTGGG - Intronic
972967181 4:44524794-44524816 AACCCAGTAATCCAATTTCTGGG - Intergenic
974342153 4:60628073-60628095 TACCTAGAAATACAACTTATAGG - Intergenic
976315670 4:83656347-83656369 AACCTAGCACTGCTACTTATTGG - Intergenic
976603467 4:86960652-86960674 AAAATAGTACAACATTTTATGGG + Intronic
977464970 4:97372475-97372497 ACCCTTGTACTATATTTTATAGG + Intronic
977847827 4:101787076-101787098 AACGCATTACTACAATTTAGTGG + Intronic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
979892176 4:126112075-126112097 TACCCAGTAATACAATTTCTGGG + Intergenic
980610605 4:135156335-135156357 AAACTAGTACAACAATTTTTGGG + Intergenic
981075644 4:140588625-140588647 AACCTGGTTCTAAAATTAATAGG - Intergenic
981221861 4:142246516-142246538 TACCTAGGAATACAATTTACAGG - Intronic
981270393 4:142840125-142840147 CATATAGTACTATAATTTATTGG - Intronic
983398752 4:167235978-167236000 AACATACTACTGCAATTCATGGG + Intergenic
983765775 4:171481087-171481109 ATCCTATTTCTAAAATTTATGGG + Intergenic
984245185 4:177267221-177267243 AACCTGGTACTACACTATCTTGG - Intergenic
987716006 5:21571992-21572014 AACTTTGTAGTACAATTTGTTGG - Intergenic
988639586 5:33026591-33026613 AACCTAGTACAAAATTTAATAGG - Intergenic
989315812 5:40077486-40077508 AACATAGCACTACAATATTTTGG - Intergenic
989731798 5:44657585-44657607 ATCCTCACACTACAATTTATTGG - Intergenic
990126484 5:52524874-52524896 ATCCCTGTACTACCATTTATTGG - Intergenic
992668800 5:79038066-79038088 AAACTAGTCCTAAAATTTATGGG + Intronic
992982959 5:82195894-82195916 AACCTAGCAGTAGAATTTCTGGG + Intronic
993569197 5:89515219-89515241 GACCTAGTAATTCAATTTCTGGG + Intergenic
994102898 5:95913361-95913383 AATCTATTAGTAGAATTTATGGG - Intronic
994163989 5:96588724-96588746 CACCATGTACTACAATTTATTGG + Intronic
995058990 5:107793490-107793512 AACCTAGTACATCACTATATGGG - Intergenic
996193506 5:120574873-120574895 AACCTAGAAATTCCATTTATAGG + Intronic
997121355 5:131176242-131176264 TACCTAGTAGTAGAATTTCTGGG + Intronic
997154121 5:131533588-131533610 AAACTAGTACTAAGATTTGTAGG + Intronic
1003186673 6:3838119-3838141 AACCTAGCAATCCTATTTATAGG + Intergenic
1004274003 6:14219961-14219983 ATCCTAGTGCTACCATTTACCGG - Intergenic
1004965848 6:20850208-20850230 AACCTAGTACTACAATTTATTGG - Intronic
1005557547 6:27002737-27002759 AACCTAGTACCATGAGTTATGGG + Intergenic
1006535766 6:34697320-34697342 TTCCTATTACTACATTTTATCGG + Intergenic
1006989499 6:38201567-38201589 AACATAGTACTAGAAGTCATAGG + Intronic
1009000715 6:57710068-57710090 AACTTTGTAGTACAATTTGTTGG + Intergenic
1011812452 6:91148668-91148690 AACCTAGTCCCACACCTTATAGG + Intergenic
1012456311 6:99410135-99410157 CACCTAGCACTATAATTTAAGGG + Intronic
1013868769 6:114729975-114729997 AACCTACTAATATAATTAATAGG + Intergenic
1014373845 6:120646702-120646724 AATTTAGTACTAAATTTTATGGG + Intergenic
1014376943 6:120688288-120688310 AACCTAATACATCAATTTCTAGG + Intergenic
1014713208 6:124833627-124833649 AATCTAGAATTACAATTTAAGGG - Intergenic
1015039559 6:128700639-128700661 TACCTAGGACTAAAATTTCTGGG + Intergenic
1017787845 6:157771331-157771353 AGCCTAGTAATACAGTTAATAGG + Intronic
1020376885 7:7497480-7497502 AACCCAGTCCTATATTTTATTGG - Intronic
1026097694 7:67359403-67359425 AAGCTATTACCACAATCTATGGG + Intergenic
1028281359 7:88933413-88933435 AACCTAGTACTGGAAGTCATAGG + Intronic
1030171532 7:106607677-106607699 ATCCTAGAAATAGAATTTATTGG - Intergenic
1030894440 7:115039748-115039770 AAGAAAGTTCTACAATTTATGGG + Intergenic
1036741769 8:11369245-11369267 AACCTAGAAGTACAATTACTGGG + Intergenic
1041165439 8:55087952-55087974 ATTATAGTTCTACAATTTATGGG + Intergenic
1041800732 8:61794813-61794835 TACCTAGTATTAGAATTTCTGGG + Intergenic
1041898443 8:62954050-62954072 AACCTACTACTACTAATCATTGG + Intronic
1042231573 8:66560641-66560663 AAGAAAGTAATACAATTTATTGG + Intergenic
1044571372 8:93722812-93722834 AACATTTTACTCCAATTTATTGG - Intronic
1046504791 8:115123623-115123645 AACCCAGTTCTATTATTTATGGG - Intergenic
1046541742 8:115592290-115592312 TAGCTAGTAATACAGTTTATGGG - Intronic
1046983533 8:120362341-120362363 AACCTAGTGAGATAATTTATAGG + Intronic
1048658113 8:136565383-136565405 TACTTAGTACTACAATTACTGGG + Intergenic
1055176873 9:73329665-73329687 AACATAGTACTAGAAGTTATAGG - Intergenic
1057084300 9:92194550-92194572 AACCTAGGAGTGCAATTTCTAGG + Intergenic
1057918347 9:99074959-99074981 CATCTTGTACTCCAATTTATAGG + Intergenic
1058015249 9:100024251-100024273 AGCCTAGTACTTCATTATATGGG - Intronic
1186196536 X:7115041-7115063 AACTGAGAACTCCAATTTATTGG - Intronic
1186823663 X:13316275-13316297 ACCTTGGTACTACAATTTCTAGG - Intergenic
1187536834 X:20148694-20148716 AACAAATTACTACAATTTAGTGG - Intergenic
1187701899 X:21970838-21970860 TACCTCCTACTACAAATTATAGG - Intronic
1188777175 X:34234233-34234255 AACCCTGTACAACAATTTATTGG + Intergenic
1189868373 X:45355092-45355114 AAACTAATAATACAATTTAAAGG - Intergenic
1192310258 X:70006235-70006257 CACCTAGGAGCACAATTTATGGG + Intronic
1193613580 X:83661248-83661270 TACCCAGTACTGCAATTGATGGG + Intergenic
1194198116 X:90921221-90921243 AACCTAGTATTGCAATTAATTGG + Intergenic
1194514945 X:94840915-94840937 TACCTAGGAATACAACTTATAGG - Intergenic
1194916716 X:99717330-99717352 GGCCTAGCACTGCAATTTATTGG - Intergenic
1197466860 X:126815391-126815413 GACCTAGAACTATAATTTAGAGG + Intergenic
1197882257 X:131179131-131179153 AACCTAGTTCTCCTATTCATTGG + Intergenic
1197993765 X:132349716-132349738 AACCTAGGAATAGAATTTCTGGG - Intergenic
1199259074 X:145749613-145749635 AAACTAGTACAACAAAATATTGG + Intergenic
1200035721 X:153328469-153328491 AATTTAGTAATACAATTTACTGG + Intergenic
1200543625 Y:4491610-4491632 AACCTAGTATTGCAATTAATTGG - Intergenic
1201371850 Y:13274153-13274175 AACCGAGTACTAAATTTAATGGG + Intronic
1201725658 Y:17148365-17148387 TACCCACTAATACAATTTATTGG + Intergenic