ID: 1004976596

View in Genome Browser
Species Human (GRCh38)
Location 6:20974030-20974052
Sequence AACAAAGAGGCCCCAAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 265}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004976596 Original CRISPR AACAAAGAGGCCCCAAAATA TGG Intronic
902586392 1:17441073-17441095 AACCAAGAGGCCCAAATCTAAGG + Intergenic
905711920 1:40112187-40112209 AAATAAAAGGCACCAAAATAGGG + Intergenic
905765040 1:40593322-40593344 GACAGAGGGGCCCCAAAATTGGG - Intergenic
907144188 1:52218131-52218153 AAAAAAGAAGCCCCAATAAATGG - Intronic
908424556 1:63993457-63993479 AAAAGAGATGCCCCAAAATTGGG - Intronic
909490994 1:76226322-76226344 AGCAAACAGGCCCCACAAAAGGG - Intronic
909590233 1:77340259-77340281 AACATAGAGGGCCAAATATATGG + Intronic
909953171 1:81744773-81744795 AAGAAAGAGGAACCTAAATACGG - Intronic
911240484 1:95459973-95459995 GAAAAAGATACCCCAAAATATGG - Intergenic
911335819 1:96578692-96578714 AACAAAGAGGGCCAAACACAGGG + Intergenic
913121021 1:115740837-115740859 AACAAAGAGGCCCACAGAGAAGG + Intronic
913463863 1:119118130-119118152 AGCAAAGAGGCACCAGAAAAAGG + Intronic
913536247 1:119775386-119775408 ATCAAAGAGGCCCCACGGTAGGG - Intergenic
913701280 1:121376668-121376690 AACAAAGAGGTACCAGAACAGGG - Intronic
914041837 1:144057135-144057157 AACAAAGAGGTACCAGAACAGGG - Intergenic
914136253 1:144903351-144903373 AACAAAGAGGTACCAGAACAGGG + Intronic
915255126 1:154622528-154622550 AAGGAAAGGGCCCCAAAATATGG + Intronic
915301019 1:154951726-154951748 AACTGAGAAACCCCAAAATATGG + Intronic
916551625 1:165855331-165855353 AGCAAAGATGTCCCCAAATAAGG + Intronic
916778514 1:167996320-167996342 AACAAAGAAGCCCAATAATGGGG - Intronic
917700446 1:177575279-177575301 AACAAAAAGGCCCCAAGCAAGGG - Intergenic
918696310 1:187550708-187550730 AACAAAGCCCCCCCAAAGTAAGG + Intergenic
919333855 1:196207145-196207167 TACAAAGAGGCCGGAAAATATGG + Intergenic
919520435 1:198581697-198581719 AACAAAGAGGCACCAGAGAAAGG - Intergenic
920488705 1:206395390-206395412 AACAAAGAGGTACCAGAACAGGG - Intronic
922198916 1:223384767-223384789 AAGAAAGAGGAGTCAAAATAGGG + Intergenic
922406204 1:225316121-225316143 AACAAAGCTGCCCCAAATTTTGG - Intronic
924803536 1:247345073-247345095 AACACAGAAGCCCAAAAATCAGG - Intergenic
1067328484 10:45292442-45292464 AACAGAGAGGACCTAATATAGGG + Intergenic
1070802429 10:79251463-79251485 AATAAAGAGGCCCCAAAGCTGGG - Intronic
1070934049 10:80279842-80279864 GACAAAGAGGCCTGAAAATATGG + Intronic
1073655893 10:105416155-105416177 AACAAAGAAGCCCCACACAAAGG + Intergenic
1074366883 10:112865188-112865210 AACAAAGAGAGCCCAGATTATGG - Intergenic
1075922901 10:126227804-126227826 AACAAAGAGGCAGAAAAAAATGG + Intronic
1075929867 10:126286742-126286764 AACAAACAGGCCCCAATCCAGGG - Intronic
1076221307 10:128735099-128735121 AAGAAAGAGGCTGCAGAATATGG + Intergenic
1077256862 11:1588951-1588973 AGAACAGAGACCCCAAAATATGG - Intergenic
1077834163 11:5909845-5909867 ATCAAAGAGGCACCAGAAAAAGG - Intronic
1079787560 11:24694043-24694065 AATAAAGTGGCCATAAAATAAGG + Intronic
1081865053 11:46355079-46355101 AACACAGAGGCCTAAAAATTAGG - Intronic
1084878551 11:72152845-72152867 AAGACAGATCCCCCAAAATAAGG + Intergenic
1085180515 11:74531736-74531758 AAAGAAGAGGCCCCCAAAGAGGG - Intronic
1087418729 11:97892387-97892409 AACTGAGAGGCACAAAAATATGG - Intergenic
1087616041 11:100487460-100487482 ATCAAGGAGGCACCAAAAAAAGG + Intergenic
1087628026 11:100619359-100619381 AGGAAAGCTGCCCCAAAATATGG - Intergenic
1088337401 11:108721496-108721518 AACAAATGGTCCCCTAAATATGG - Intronic
1089118421 11:116114450-116114472 AACAAAGGGGCCTGAAAATCAGG - Intergenic
1091018190 11:132073183-132073205 AACAACGAGGAGCCAAAATGGGG + Intronic
1091038159 11:132252428-132252450 AGCAGAGAGTCCCCAAAAAAGGG + Intronic
1091067807 11:132532964-132532986 AACAAAGATCTGCCAAAATACGG - Intronic
1092788403 12:12050470-12050492 AACAAAGAGCCTCAAAAATATGG + Intronic
1093665430 12:21807160-21807182 AATAAATAGGGCCCAACATATGG - Intronic
1093989605 12:25575145-25575167 AGAAAAAAAGCCCCAAAATAGGG + Intronic
1098708019 12:73715964-73715986 AACAAAGATGTCCCCAAACAAGG - Intergenic
1098834209 12:75401781-75401803 AACAAAATTTCCCCAAAATATGG + Intronic
1099487674 12:83248599-83248621 AATAAAGATACCCCAAAATGTGG + Intergenic
1100361957 12:93887400-93887422 AACACAGAGGATACAAAATAAGG + Intronic
1100373118 12:93987752-93987774 AACTTAGATGCCCTAAAATAGGG + Intergenic
1101292369 12:103384292-103384314 AACAAAAAGGCAACTAAATATGG + Intronic
1102079744 12:110088217-110088239 AAAAAAGAAGTCCCAAAGTAGGG - Intergenic
1103471625 12:121186306-121186328 AACAAATAAGCCCCAAACTTAGG - Exonic
1105008140 12:132735937-132735959 AAGAAAATGGCCCCAAAATTAGG - Intronic
1105052346 12:133065905-133065927 CACAAAGAGGCCCCGGCATAAGG - Intergenic
1106920313 13:34556266-34556288 AACAAAGAAGCCTCATGATAAGG + Intergenic
1107320054 13:39177038-39177060 AGAAAAGAGGCCCCAAAGCAAGG - Intergenic
1108405197 13:50094028-50094050 AATATAAATGCCCCAAAATAAGG - Intronic
1108549371 13:51527855-51527877 AACAAAGAGTCCAAGAAATATGG + Intergenic
1108896233 13:55332716-55332738 AACACTGATACCCCAAAATATGG - Intergenic
1109673336 13:65638699-65638721 AATAAGGAGGCCCCATAACATGG + Intergenic
1109849200 13:68038130-68038152 TACAAATGGGCCCAAAAATATGG + Intergenic
1109892671 13:68636178-68636200 AACTAAGAAGCCCCCAAAGATGG - Intergenic
1110968157 13:81726939-81726961 AACAAAGAATCCGCAAAAAAGGG - Intergenic
1111860893 13:93704302-93704324 TGCAAATAAGCCCCAAAATAAGG + Intronic
1112253283 13:97803638-97803660 AAATAAAAGGCACCAAAATAGGG + Intergenic
1112755002 13:102622935-102622957 TACAAAGAAGCCCAAGAATATGG + Exonic
1113248799 13:108428636-108428658 AACAAAGAGACCCCCACAGAAGG + Intergenic
1116699171 14:48216568-48216590 AACAATGTGGCCCCAAATTAAGG - Intergenic
1119528693 14:75343849-75343871 AACCAAGATCCTCCAAAATATGG - Intergenic
1120729608 14:87988185-87988207 TGCAAAGAGGCACCAAAATTCGG + Exonic
1121639600 14:95476228-95476250 ATCAAAGAGGCCTCAACCTAAGG + Intergenic
1122108341 14:99478122-99478144 AAAAAAAGGGCCCAAAAATAAGG + Intronic
1122765625 14:104067576-104067598 AATAAAGATGCCTGAAAATAAGG - Intergenic
1123502454 15:20902349-20902371 CACAAAGAGGCACTAAAACAGGG + Intergenic
1123559704 15:21476016-21476038 CACAAAGAGGCACTAAAACAGGG + Intergenic
1123595938 15:21913315-21913337 CACAAAGAGGCACTAAAACAGGG + Intergenic
1127133073 15:55888452-55888474 ATCAAAGAGGACACAAAAAATGG + Intronic
1127353679 15:58177148-58177170 AATAAGGTGACCCCAAAATATGG - Intronic
1128357057 15:66935408-66935430 ACCCAAAAGGCCCCAAAAGAAGG - Intergenic
1129816985 15:78564250-78564272 AACAAAGGGGCCACAGAAAAGGG - Intergenic
1130771956 15:86933346-86933368 AACCAAAAGGCCACAAAATAAGG + Intronic
1131301210 15:91201206-91201228 TACAAAGAGGCACCCAAAAAGGG - Intronic
1202968046 15_KI270727v1_random:203178-203200 CACAAAGAGGCACTAAAACAGGG + Intergenic
1134272979 16:12750437-12750459 AATAAGGAGGCCCCAAAAGAGGG + Intronic
1138916823 16:61474496-61474518 ATTAAAGAGGACACAAAATATGG + Intergenic
1139287906 16:65831898-65831920 GACAACCAGGCCACAAAATAAGG + Intergenic
1140467604 16:75195014-75195036 AAAGAAGAGGAGCCAAAATAGGG + Intergenic
1144927334 17:18823291-18823313 ATCAAAGATGACCCAAAAAAGGG + Intergenic
1149192099 17:54075174-54075196 AATAGAGAGGCCCAAGAATAAGG - Intergenic
1150440471 17:65187295-65187317 AACAAAGAGTCACACAAATAAGG + Intronic
1150971766 17:70036110-70036132 AACAGAGAGACCACAAAACAAGG - Intergenic
1153456565 18:5289048-5289070 AAAAATGAAGTCCCAAAATATGG + Exonic
1154063546 18:11085541-11085563 TACTAAGAGCCCCCTAAATAGGG - Intronic
1155304991 18:24470156-24470178 GACAAAGAGTCTCCAAAATGTGG + Intronic
1155593879 18:27459978-27460000 AATACAGAGGATCCAAAATATGG + Intergenic
1156832259 18:41505959-41505981 ATCAGAGAGGCCTCAAATTATGG + Intergenic
1157171311 18:45408799-45408821 CAAAAAGAGGACCCAGAATATGG + Intronic
1157234727 18:45953676-45953698 AACACAGAGCCCCCAAAGGAAGG - Intronic
1157234897 18:45955085-45955107 AACACAGAGCCCCCAAAGGAAGG - Exonic
1158334549 18:56401810-56401832 AACAAATTTGTCCCAAAATAGGG + Intergenic
1158605180 18:58889782-58889804 AACAAAAAAACCCCAAAATTTGG + Intronic
1162002632 19:7756941-7756963 TACAAAGATACCCCAAAATGTGG + Intergenic
1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG + Intronic
1164286459 19:23821638-23821660 AACAAAGAGGCCCCCAGCCAAGG - Intronic
1166595030 19:44039432-44039454 AACAAAGAAAGCCCAAAATTAGG + Intergenic
925107307 2:1302966-1302988 AACAACGGGGCTGCAAAATATGG + Intronic
926081391 2:9989412-9989434 AACAAACACGGCCCAAAATCAGG - Intronic
926427206 2:12749749-12749771 AACAAAAAGAGCCCAAGATATGG - Intergenic
926759027 2:16261137-16261159 AACAAACAGGGCCTAAACTAGGG + Intergenic
926952460 2:18258022-18258044 TATAAAGAGGCCTGAAAATATGG - Intronic
928041444 2:27881739-27881761 AATAAAGAGCCCCCAAAATAAGG + Intronic
929463058 2:42119105-42119127 AACAAAGGGGCACGAAAATTTGG - Intergenic
929615892 2:43306995-43307017 AACCAAGAGGCCTCAAGACAAGG + Intronic
931127675 2:59295801-59295823 ATGAAAGGGGCCCCAAATTATGG - Intergenic
932504798 2:72218386-72218408 AATAAAGAGGCCACTCAATAAGG + Intronic
933526946 2:83453615-83453637 AATAAATAGGCCCCAGGATACGG - Intergenic
934158030 2:89221398-89221420 TACAAAGAAGCCTCAAAATATGG - Intergenic
934159221 2:89232226-89232248 TACAAAGAAGCTTCAAAATATGG - Intergenic
934169446 2:89327390-89327412 TACAAAGAAGCCTCATAATATGG - Intergenic
934197848 2:89855195-89855217 TACAAAGAAGCCTCATAATATGG + Intergenic
934208052 2:89950199-89950221 TACAAAGAAGCTTCAAAATATGG + Intergenic
934209235 2:89961026-89961048 TACAAAGAAGCCTCAAAATATGG + Intergenic
934790212 2:97053495-97053517 TACAAAGAAACCTCAAAATATGG + Intergenic
934816256 2:97329042-97329064 TACAAAGAAACCTCAAAATATGG - Intergenic
934821440 2:97379442-97379464 TACAAAGAAACCTCAAAATATGG + Intergenic
935228858 2:101078680-101078702 TTCAAAGATGTCCCAAAATAGGG - Intronic
937154760 2:119711049-119711071 AAGAGAGAGGCACCAAAAGAGGG + Intergenic
937521423 2:122717312-122717334 AATACAGAGCCCCCAAATTAAGG + Intergenic
938031277 2:127996261-127996283 AACAAAGTGTCCCACAAATATGG - Intronic
943049996 2:182902539-182902561 AAAAAAAAGTCCCCAAAGTATGG - Intergenic
943189453 2:184657461-184657483 AACAAAAAGCCCCAAAAGTAGGG - Intronic
944301304 2:198127980-198128002 AATAAAGCGGCTCTAAAATAAGG + Intronic
944750082 2:202700071-202700093 AACAAAGAGGCCCAATGAGAGGG - Intronic
946659008 2:221979347-221979369 AAAAAGCAGGCCCCAAGATAAGG - Intergenic
948023894 2:234760812-234760834 GGCAAAGAGGATCCAAAATATGG - Intergenic
1169683266 20:8241362-8241384 GAGAAAGAGGACCCAAAATGAGG - Intronic
1174479604 20:50821515-50821537 AAAAAAGAGGCCCCAAGCTAGGG - Intronic
1174505367 20:51014320-51014342 ATCAAAGAGGCCCCAAAGCCTGG + Intronic
1175007419 20:55700081-55700103 AAAAATGATGCCCCCAAATAGGG - Intergenic
1177180558 21:17740299-17740321 GACAATGATGCCCCAAAGTATGG - Intergenic
1178789066 21:35681771-35681793 AAACAAGAAGCTCCAAAATACGG - Intronic
1182360091 22:29741207-29741229 GCCAAAGAGGCACCAAAATCTGG + Intronic
949796495 3:7856865-7856887 AATAAACTGGCCCTAAAATAAGG - Intergenic
950630012 3:14276043-14276065 AGAAAACAGCCCCCAAAATAGGG - Intergenic
950827258 3:15837137-15837159 AACAAAACAGTCCCAAAATAGGG + Intronic
952809818 3:37391737-37391759 AACAAAAACCCCCCAAAAAAAGG + Intronic
953505283 3:43480192-43480214 AACAAGGAGACACAAAAATAGGG + Intronic
953754137 3:45632058-45632080 AACAAAGAGGCCACAGCATTTGG + Intronic
953968331 3:47327297-47327319 ATCAAAGACACCCAAAAATAAGG + Intronic
955953329 3:64263793-64263815 AACCAAGATGACCCAAGATAAGG - Intronic
955979747 3:64512870-64512892 AACAAAGAGACTCCAAAATGAGG - Intergenic
957692892 3:83595483-83595505 TAAAAAGATACCCCAAAATATGG + Intergenic
960657835 3:120025518-120025540 AACAAAGATGATCCAATATAAGG + Intronic
962099012 3:132322220-132322242 AACACAGAGGCCTGCAAATAAGG - Intronic
963320712 3:143806341-143806363 AACACAGATGCCACAAAAGAGGG - Intronic
963615846 3:147536965-147536987 AAAAAGGAGTCCCCAAAATTGGG - Intergenic
963847669 3:150176073-150176095 AACATAGAAGCCCCAAATCAGGG + Intergenic
965195679 3:165591241-165591263 AACAAACTGCCCCCAAAATTTGG + Intergenic
966344495 3:178963691-178963713 AAAAGCGATGCCCCAAAATATGG + Intergenic
966503035 3:180667657-180667679 AATAGAGAGGCCCCAAAAGAGGG - Intronic
967002931 3:185354169-185354191 AACAAAGATGCCCCAAGTTGAGG - Intronic
967737678 3:192970537-192970559 AACAAAGACGCCAAGAAATATGG - Intergenic
968073891 3:195805337-195805359 AACCAAGAAGCACCAAAATCCGG + Intronic
968392312 4:203669-203691 GAGAAACTGGCCCCAAAATAGGG - Intergenic
970835335 4:20398182-20398204 AACAAAGAGGACCCAAGAGAGGG + Intronic
971609703 4:28707530-28707552 AATAGGGAGGCCCCAAAAGAGGG - Intergenic
971810358 4:31417274-31417296 ACTAAAGAGGCCCCAAGAAAGGG - Intergenic
971962440 4:33506858-33506880 TACAATGATGCCCCAAAACATGG + Intergenic
972097217 4:35363691-35363713 ATCAAAGAGGCACCACAAAAAGG - Intergenic
972634297 4:40869600-40869622 ATAAAAGAGGCCTAAAAATAAGG + Intronic
973560247 4:52128201-52128223 AAGAGAGAGACCCCAAATTAGGG - Intergenic
974001540 4:56516386-56516408 TAAAAAGATGCCACAAAATAGGG + Intronic
974190834 4:58500567-58500589 AATACAGAGGCCCCATAATCAGG + Intergenic
975438075 4:74377303-74377325 AACATAGAGGCCACAAATTATGG - Intronic
976430575 4:84959243-84959265 ATCAAAGAGGCGCTAAAACATGG - Intronic
977194447 4:94042162-94042184 AATATGGAGGCCCCAAAAGAGGG + Intergenic
978075676 4:104526557-104526579 AACAATGACATCCCAAAATATGG - Intergenic
980007049 4:127554303-127554325 AAGATAAAGTCCCCAAAATAGGG + Intergenic
980977707 4:139626830-139626852 AAAACAAAGGCCCCAAAATATGG + Intergenic
982816060 4:159886219-159886241 TTCAAAGATGCCCCAAAATGAGG - Intergenic
983773811 4:171582142-171582164 AACCAAGGAGCCTCAAAATAAGG + Intergenic
983874600 4:172861980-172862002 TGAAAAGAGGCCCCAAAATGTGG + Intronic
985374456 4:189320030-189320052 ATTAAAGAGGACACAAAATAAGG - Intergenic
985481558 5:114448-114470 AACAAACAAACACCAAAATATGG - Intergenic
986860986 5:11926580-11926602 AAAACTGATGCCCCAAAATATGG + Intergenic
987968365 5:24907636-24907658 AGCAAAGAGTCCCCAATATCTGG - Intergenic
989321181 5:40135645-40135667 TACATGGTGGCCCCAAAATAAGG + Intergenic
989609880 5:43280653-43280675 AAGAAAGAGACCTCAAAAAAGGG + Exonic
990554660 5:56919110-56919132 AAAAAAGAAGTCCCAAAGTAAGG - Intergenic
990743946 5:58939131-58939153 AACAAAGAGACCCTAAAATTAGG - Intergenic
990812417 5:59743205-59743227 AAAAGAGAGCCCCCAAAAAATGG + Intronic
992152778 5:73922315-73922337 TACAAAGGCTCCCCAAAATATGG - Intronic
992783252 5:80146905-80146927 AATGAAATGGCCCCAAAATAAGG + Intronic
993212561 5:84971962-84971984 AACAAAAAGACCATAAAATACGG - Intergenic
993325675 5:86532770-86532792 AACAAAAGAGCCCCACAATATGG - Intergenic
993980854 5:94542402-94542424 AACAAATATGCCCCAAATTTTGG - Intronic
994296085 5:98089892-98089914 AACAATTAGCCCCCAAACTAGGG + Intergenic
994917314 5:105996666-105996688 AAGAAACATGCCTCAAAATAAGG - Intergenic
994978318 5:106840201-106840223 AACAAAGCCCCCCAAAAATATGG + Intergenic
995214564 5:109580962-109580984 AACAAAAAAACCCCAAGATAGGG + Intergenic
996833473 5:127765883-127765905 AACGAAGAGTCTCCATAATATGG - Intergenic
998380649 5:141722825-141722847 AACAAAGAGGCCCAAATAACAGG - Intergenic
998518352 5:142777164-142777186 AACAAATAGTCCCCAAAAGAGGG - Intronic
998985614 5:147752952-147752974 AACAGAGAGGCCCTATAAAAAGG - Intronic
1004976596 6:20974030-20974052 AACAAAGAGGCCCCAAAATATGG + Intronic
1005392863 6:25350857-25350879 AACAAAAATGCCCCAAAAGGGGG - Intronic
1005466504 6:26121193-26121215 AACAAAAACACCCCAAAAAAAGG + Intronic
1006020492 6:31114959-31114981 AACACTGAGGGCCCTAAATAAGG + Intronic
1007501017 6:42296888-42296910 GACAAACAAGCCACAAAATATGG + Intronic
1008302520 6:49858863-49858885 CACAAAGAAGAACCAAAATAAGG + Intronic
1009482418 6:64175824-64175846 AACTAAGAGGACCTAAAATGGGG + Intronic
1009506343 6:64485079-64485101 CACAAAGTGGCCCCCAAAAAAGG + Intronic
1010149937 6:72719597-72719619 AAGCAAGAGGCCCCAAAATTAGG - Intronic
1010835728 6:80585776-80585798 TCTAAAGATGCCCCAAAATATGG + Intergenic
1011095782 6:83660382-83660404 AAAAAAGTAGCCCCAAACTAAGG + Intronic
1011492267 6:87904334-87904356 AACAAACAGGCCTTAAAGTAAGG - Intergenic
1011870646 6:91887823-91887845 AACAAAAAAGCCCTAAACTAGGG - Intergenic
1012136541 6:95564204-95564226 AAAAAAGAGGCCAAAAATTATGG + Intergenic
1012392604 6:98760001-98760023 AACAGAGAGGCCCAAGAAGAGGG - Intergenic
1013643817 6:112115649-112115671 AACAAAGAGTCATAAAAATATGG - Intronic
1014266242 6:119281199-119281221 AATAAAGTGGCACCAAAGTAGGG - Intronic
1014530993 6:122559179-122559201 AACAAACAGTCCCCAAAAAGTGG + Intronic
1014701655 6:124696375-124696397 GAAAATGATGCCCCAAAATATGG - Intronic
1018441817 6:163820658-163820680 GACAAAGACGCTACAAAATAGGG - Intergenic
1018514203 6:164561288-164561310 TATAAAGATGCCCCAAAATGTGG + Intergenic
1020225245 7:6274288-6274310 GACAAAGAGGCACCAGAAAAGGG + Intergenic
1023436951 7:40149103-40149125 AAAACTGAGACCCCAAAATATGG - Intronic
1026897005 7:74015059-74015081 CAGAAAGAGGTCCCCAAATAAGG - Intergenic
1027484257 7:78740221-78740243 ATAAAAGAGACCCCAGAATAAGG - Intronic
1028676742 7:93473010-93473032 AACAAAGAAGTCCAAAACTAAGG + Intronic
1028713353 7:93936292-93936314 AAGAAAGAAGCCTCTAAATATGG - Intergenic
1029328392 7:99829986-99830008 AAAAATGAAACCCCAAAATATGG + Intronic
1031153774 7:118085270-118085292 AACAAAGAGACCCTAAAGTCAGG + Intergenic
1031312860 7:120220579-120220601 AACAAATAGTCCCCAAAAGTAGG + Intergenic
1031445699 7:121850966-121850988 GAGAAAGAGCCCCCAAAATGTGG + Intergenic
1032007496 7:128314763-128314785 CACACCGAGGCCCCAAAATCAGG - Exonic
1032285148 7:130534048-130534070 AACAAAGAATTCCCAAAATGGGG + Intronic
1032680575 7:134178682-134178704 AATAAAGGGGTCACAAAATAGGG - Intronic
1032727831 7:134607546-134607568 AATAAAGAGTCCACAGAATAAGG - Intergenic
1032930387 7:136660651-136660673 TACAAAGAGGTCCCAAAAGCAGG - Intergenic
1033139819 7:138816178-138816200 AATAGGGAGGCCCCAAAAGAGGG - Intronic
1034261305 7:149757918-149757940 GACAACGATGCCCCATAATAGGG + Intergenic
1040583556 8:48717179-48717201 AACACAAAGGGCCTAAAATAGGG + Intronic
1040691365 8:49942688-49942710 ATCAAAGAAACCCCAATATAGGG - Intronic
1041372555 8:57178075-57178097 AATGAGGAGGCCCCAAAAGAGGG + Intergenic
1042515758 8:69657268-69657290 AACAAAGAGGAAGCAAAAGATGG - Intronic
1042622167 8:70718246-70718268 AACAAAGATACCCAAAAATGTGG - Intronic
1042886575 8:73559306-73559328 AACATAGAGACCCCAGAACAGGG + Intronic
1042910983 8:73825809-73825831 AACAAACAGACCTCAAACTAAGG + Intronic
1044267046 8:90194213-90194235 CACATAGTGGCCCCAAAAAAGGG + Intergenic
1044319346 8:90785001-90785023 AGCAGAGAGGCCTCAAAATCTGG - Intronic
1047839725 8:128738173-128738195 CAGAAAGAGGACACAAAATAAGG + Intergenic
1048416909 8:134236348-134236370 TATAAAGATACCCCAAAATATGG - Intergenic
1048876030 8:138837631-138837653 GACACAGAGGCCCCAATACAGGG - Intronic
1051077170 9:13252769-13252791 AATAAAGATGCCCCAATATAAGG + Intronic
1052401378 9:28004769-28004791 GAGAAAGAGACACCAAAATAGGG + Intronic
1056484246 9:87038809-87038831 AACAATGAGACCAGAAAATAGGG + Intergenic
1056997554 9:91477759-91477781 AACAAAGAGACCCCAAAAGTGGG + Intergenic
1057093788 9:92285448-92285470 AACAGAGAGGCACAAAAATATGG + Intronic
1057713891 9:97472837-97472859 AACATAAATGCCCCAAAAGAAGG + Intronic
1057831688 9:98412079-98412101 AAAAGAGAGGCCCCAACAAAGGG - Intronic
1058573243 9:106370957-106370979 TACAAGGATACCCCAAAATATGG - Intergenic
1060421453 9:123472444-123472466 AAGAAAGATGCCCCCAAATGAGG - Intronic
1186351384 X:8743092-8743114 AAAAAAGAGGCCGCAAATTGAGG - Intergenic
1186942339 X:14523674-14523696 AATAGGGAGGCCCCAAAACAGGG + Intergenic
1188000382 X:24974820-24974842 AACAAAGAAACCCTAATATAGGG + Intronic
1189710912 X:43811061-43811083 AACATACAGGCTCCAAAATGAGG - Intronic
1191005224 X:55703906-55703928 AACAAAGACCCCCCAAAATATGG + Intergenic
1191779614 X:64851045-64851067 AACAAGGAGACCCCAAAGTCAGG - Intergenic
1193041439 X:77007827-77007849 AAGAAAAATGCCCCAAAATAGGG - Intergenic
1193462633 X:81809071-81809093 AACAAAAAAGGCCCAAAAAATGG - Intergenic
1194228029 X:91286349-91286371 TACAAAGAGGCAGAAAAATATGG - Intergenic
1194279662 X:91933902-91933924 AACAAAAATCACCCAAAATAGGG + Intronic
1195715884 X:107818446-107818468 AACAAAGACACCTGAAAATATGG + Intergenic
1196429043 X:115602688-115602710 AACAAAGAGGGGACAAAACATGG - Intronic
1197703500 X:129617138-129617160 GACAAAGAGACCCCAAAAAAGGG - Intergenic
1199043129 X:143138408-143138430 AATAAAGATACCCCAAAATGTGG + Intergenic
1200597139 Y:5157383-5157405 AACAAAAATCACCCAAAATAGGG + Intronic
1202240009 Y:22757162-22757184 ATCAAAGAGGCACCAGTATAGGG - Intergenic
1202392995 Y:24390924-24390946 ATCAAAGAGGCACCAGTATAGGG - Intergenic
1202477790 Y:25279193-25279215 ATCAAAGAGGCACCAGTATAGGG + Intergenic