ID: 1004978738

View in Genome Browser
Species Human (GRCh38)
Location 6:20998288-20998310
Sequence CATACTGCACACTTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004978738_1004978743 -2 Left 1004978738 6:20998288-20998310 CCCAGCTCCAAGTGTGCAGTATG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1004978743 6:20998309-20998331 TGGCTACAAAGAGGCTGCTGAGG 0: 1
1: 0
2: 1
3: 36
4: 284
1004978738_1004978744 3 Left 1004978738 6:20998288-20998310 CCCAGCTCCAAGTGTGCAGTATG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1004978744 6:20998314-20998336 ACAAAGAGGCTGCTGAGGCCAGG 0: 1
1: 1
2: 6
3: 83
4: 494
1004978738_1004978746 11 Left 1004978738 6:20998288-20998310 CCCAGCTCCAAGTGTGCAGTATG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1004978746 6:20998322-20998344 GCTGCTGAGGCCAGGCGCGGTGG 0: 1
1: 4
2: 68
3: 509
4: 3467
1004978738_1004978745 8 Left 1004978738 6:20998288-20998310 CCCAGCTCCAAGTGTGCAGTATG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1004978745 6:20998319-20998341 GAGGCTGCTGAGGCCAGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004978738 Original CRISPR CATACTGCACACTTGGAGCT GGG (reversed) Intronic
900974957 1:6011233-6011255 CCTCCTGCACACTTGGCCCTGGG - Intronic
904463324 1:30693242-30693264 CAGGCTGCTCACTTGGAGGTGGG - Intergenic
914453212 1:147811569-147811591 CAGACGGCATGCTTGGAGCTGGG - Intergenic
916925683 1:169518266-169518288 CATCCTGGACTCTTGGACCTAGG + Intronic
917813830 1:178687414-178687436 TATACTCCACCCTTGGAGCAGGG - Intergenic
922807851 1:228399778-228399800 GATGCTGCAGACTTGGAGGTGGG + Intronic
924010591 1:239660939-239660961 AATAATGCACACATAGAGCTTGG - Intronic
924439246 1:244072853-244072875 GCTACTGCACACTTGGGCCTGGG + Intergenic
924597446 1:245459760-245459782 AATAGTGCAGACCTGGAGCTAGG + Intronic
1065432311 10:25672226-25672248 CATCCTACACACTTGTAGTTTGG - Intergenic
1066449973 10:35520081-35520103 TAAAATGCACACTGGGAGCTGGG + Intronic
1070509159 10:77144746-77144768 CATACTGCCCACTGGAAGTTGGG - Intronic
1075559554 10:123458596-123458618 CATACTGCAAACTCGGGACTTGG + Intergenic
1077878540 11:6328375-6328397 CATACTTCACAATGTGAGCTTGG - Intergenic
1080637967 11:34140149-34140171 CATACTGAACACATGGACCAAGG - Intronic
1088173817 11:107027385-107027407 CACAATGAACACTTGCAGCTAGG + Intergenic
1092344370 12:7703279-7703301 CATACTGTACACTTTGATTTTGG + Intergenic
1103083593 12:118044323-118044345 CATACTGCAGGTTTGGAACTAGG + Intronic
1104944727 12:132410493-132410515 AATCCTGCAGACCTGGAGCTGGG + Intergenic
1105212791 13:18267178-18267200 CATGCTGCAGACTTGGGGCATGG - Intergenic
1106343883 13:28857453-28857475 GATACTGCACACGTGGAGTGGGG + Intronic
1106477499 13:30111020-30111042 CAGACTGCTCACAGGGAGCTTGG + Intergenic
1112520488 13:100090218-100090240 CATACTGCCCACCTGGGGCTCGG - Intronic
1115453872 14:33578973-33578995 CATACTGCTGACATTGAGCTTGG - Intronic
1118233320 14:63975145-63975167 CATACACGACACATGGAGCTGGG + Intronic
1122094783 14:99362968-99362990 CCTTATGCACACTTGGGGCTGGG - Intergenic
1122224299 14:100264622-100264644 GCTACTGCAGACTTTGAGCTGGG + Intronic
1123945705 15:25237868-25237890 GCTTCAGCACACTTGGAGCTGGG - Intergenic
1124023786 15:25946242-25946264 CCTCCTGCCCACCTGGAGCTTGG - Intergenic
1126675540 15:51156831-51156853 CTTATTGCACACTTGGGGCTTGG + Intergenic
1128386217 15:67150506-67150528 CAGACTGCACGCTTGGGGGTGGG - Intronic
1130288138 15:82572304-82572326 AATACTGTACACTTGGACCCTGG + Intronic
1133403726 16:5507017-5507039 CATAATGGACCCCTGGAGCTTGG + Intergenic
1141588091 16:85048432-85048454 CATGCTGCACGATTGGATCTGGG + Intronic
1145045724 17:19614126-19614148 CTTACTGCACACAAGAAGCTGGG - Intergenic
1150460412 17:65345748-65345770 CTTCCTGCACTCTTTGAGCTTGG + Intergenic
1152920222 17:83062822-83062844 CATCCAGCACAGTTGGGGCTGGG + Intergenic
1153505456 18:5792251-5792273 CAAACTGGAGACCTGGAGCTGGG - Intergenic
1154054237 18:10995862-10995884 CATACTGCTCACATGAATCTAGG + Intronic
1157125509 18:44952225-44952247 GATTCTGAACACTTGGAACTTGG - Exonic
1157515051 18:48304810-48304832 CATCCTGCACAATGGGAGCCAGG + Intronic
1159563156 18:70017167-70017189 CATACTGGACACCTGGAGGAAGG - Intronic
1160922419 19:1527117-1527139 CATACTGCACACTTGGCGACAGG - Intronic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
929022084 2:37563455-37563477 CATTCTGCACACTTGTAGGGCGG + Intergenic
930033164 2:47070359-47070381 GATGCTGCCCACGTGGAGCTTGG - Intronic
930491789 2:52082920-52082942 TATAATGCACAGTTGGAGCCTGG + Intergenic
932192509 2:69752728-69752750 CATACTGCACACTTCTAGCAAGG - Intronic
933851468 2:86370195-86370217 AACACAGTACACTTGGAGCTGGG + Intergenic
935454318 2:103249656-103249678 CATTCTGAACACTAGGAGTTAGG + Intergenic
940395674 2:153187798-153187820 GATTCTGTATACTTGGAGCTGGG + Intergenic
941463980 2:165803317-165803339 CTTACTCCCCACTTTGAGCTGGG + Intergenic
945042227 2:205751967-205751989 CATACTGGATTTTTGGAGCTGGG + Intronic
947466703 2:230356580-230356602 CATACTGAACACATGCAGCCAGG - Intronic
948317490 2:237039540-237039562 CTTCCTGCACACCTGGAGCCCGG - Intergenic
1169804489 20:9545275-9545297 CATACTGCACCCTGGGTGTTAGG + Intronic
1170940479 20:20844443-20844465 GATGCTGCACACGTGAAGCTTGG + Intergenic
1172576645 20:36014288-36014310 CACACTTAACACTTGGATCTTGG + Intronic
1179470250 21:41605564-41605586 CCCACTGCCCACTTGGAGCCTGG - Intergenic
1181201797 22:21221837-21221859 CATGCTGCAGACTTGGGGCATGG - Intronic
1181780090 22:25186241-25186263 CATAATGCACACTTGAGGATGGG + Intronic
1184335660 22:43851680-43851702 CAGGCTGCACACTTGGAGGGTGG - Intronic
1185041590 22:48507119-48507141 CCTACTGCACACCTGGCCCTTGG - Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
1185271482 22:49931281-49931303 CTCACTGCACACCTGGGGCTGGG + Intergenic
1203225115 22_KI270731v1_random:73591-73613 CATGCTGCAGACTTGGGGCATGG + Intergenic
1203265713 22_KI270734v1_random:13193-13215 CATGCTGCAGACTTGGGGCATGG - Intergenic
950721806 3:14888424-14888446 CCTACTGCACAGCTGGGGCTGGG - Intronic
951056124 3:18148439-18148461 CATATTGCCCACTTGATGCTGGG - Intronic
951323143 3:21271627-21271649 CACACTCCACACTGGTAGCTGGG + Intergenic
952840721 3:37643117-37643139 CAGATTGCACACTTGGAGTCAGG + Intronic
954213687 3:49112359-49112381 CAGGCTGCACACTTGGAGATGGG + Exonic
954929577 3:54269455-54269477 TGTACTGCATACTAGGAGCTGGG + Intronic
955941774 3:64152748-64152770 CATAGTCCCCACTTGGAGGTGGG + Intronic
960522029 3:118666033-118666055 CATATTGCCCTGTTGGAGCTTGG - Intergenic
960788602 3:121401125-121401147 CATACTGAACACATGCAGCCAGG - Intronic
967955689 3:194875784-194875806 CACACTGCACACATGTAGCAGGG + Intergenic
976429445 4:84945989-84946011 GCTACTGCACACCTGGGGCTAGG + Intronic
983729102 4:170971528-170971550 CAGACTGCACACTCTGAGCCTGG + Intergenic
991385157 5:66079584-66079606 GAAACAGTACACTTGGAGCTAGG + Intronic
995841660 5:116447978-116448000 CATACTGCACACGAGGGGCTTGG - Intronic
997137172 5:131338807-131338829 CATACTGCACACTGGTATGTAGG - Intronic
998662709 5:144257892-144257914 CTTACTGAACTCTTAGAGCTTGG - Intronic
1004978738 6:20998288-20998310 CATACTGCACACTTGGAGCTGGG - Intronic
1007924116 6:45637581-45637603 CACACTGCATGCTGGGAGCTGGG - Intronic
1008292875 6:49739154-49739176 AATACAGCACACTAGGAGTTAGG - Intronic
1008537216 6:52515596-52515618 CATACTGCAAAATTTGAGCTTGG + Intronic
1010368906 6:75085006-75085028 CAGACTGCGTGCTTGGAGCTAGG + Exonic
1011894797 6:92212148-92212170 CATACTGCTTACCTGGAGCAGGG - Intergenic
1018943587 6:168328973-168328995 CACACTGCTTAGTTGGAGCTCGG - Intergenic
1021371335 7:19851730-19851752 CATACTGGAAACTTGTTGCTTGG + Intergenic
1021813599 7:24426611-24426633 TATGCTGCACACTTGCAGTTTGG - Intergenic
1024645315 7:51366165-51366187 GATAATGGACACTTGGAGCAAGG + Intergenic
1025019487 7:55469574-55469596 TATTCTGCACCCTTGCAGCTGGG - Intronic
1033915082 7:146314525-146314547 CATACTGCTCACTTTGAACCTGG + Intronic
1035333703 7:158112635-158112657 CATCCTGCACACGTGGACATGGG + Intronic
1035360626 7:158311042-158311064 CATCCTGGGCCCTTGGAGCTTGG - Intronic
1038219136 8:25591135-25591157 CACACTGTACACTCTGAGCTTGG + Intergenic
1044801467 8:95961557-95961579 CACACTGAACACTTGGACTTGGG + Intergenic
1048313484 8:133344466-133344488 CCCACTGCACACATGCAGCTAGG + Intergenic
1048939688 8:139388096-139388118 CATACTGCACACTTGAAAATGGG - Intergenic
1050627747 9:7523519-7523541 GTTACTGCTCATTTGGAGCTGGG - Intergenic
1056069091 9:82967453-82967475 CCTAGTGGACACTTGGAGGTGGG - Intergenic
1061400454 9:130365504-130365526 CAAGCTGCCCACTTGGAGCACGG - Intronic
1187649189 X:21381696-21381718 CAGCCTGCATACTTGGTGCTGGG - Intronic
1187967172 X:24623515-24623537 CAGACCACAGACTTGGAGCTAGG + Intronic
1188462161 X:30440977-30440999 CATTCTGCCCACCTGGAACTGGG + Intergenic
1193494256 X:82190931-82190953 CATTTTGCACACTTCCAGCTGGG - Intergenic
1194014726 X:88605112-88605134 CAGCCTGCACACTTGGAGGAAGG + Intergenic
1198183679 X:134234339-134234361 GCTACTGCAGACTTGGAGATAGG - Intergenic
1202193097 Y:22264957-22264979 TGTACTGCACATTTGGAACTTGG - Intergenic