ID: 1004979754

View in Genome Browser
Species Human (GRCh38)
Location 6:21010462-21010484
Sequence CAAGTGATGAAATGGATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004979754_1004979759 10 Left 1004979754 6:21010462-21010484 CCAGAGATCCATTTCATCACTTG 0: 1
1: 0
2: 0
3: 3
4: 124
Right 1004979759 6:21010495-21010517 AAGGAGAAAGAGTCAATGATGGG No data
1004979754_1004979758 9 Left 1004979754 6:21010462-21010484 CCAGAGATCCATTTCATCACTTG 0: 1
1: 0
2: 0
3: 3
4: 124
Right 1004979758 6:21010494-21010516 CAAGGAGAAAGAGTCAATGATGG 0: 1
1: 0
2: 1
3: 41
4: 475
1004979754_1004979757 -9 Left 1004979754 6:21010462-21010484 CCAGAGATCCATTTCATCACTTG 0: 1
1: 0
2: 0
3: 3
4: 124
Right 1004979757 6:21010476-21010498 CATCACTTGCTGCAGGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004979754 Original CRISPR CAAGTGATGAAATGGATCTC TGG (reversed) Intronic
900864359 1:5257267-5257289 CACGTGATGAAAGGTATCTATGG - Intergenic
902403734 1:16172130-16172152 CAATAGATGACATGGATCTGGGG - Intergenic
903536617 1:24071235-24071257 CCAGTGATCAAACTGATCTCCGG - Exonic
905146691 1:35892754-35892776 CAAAAGATGAAAAGGATCTCTGG - Intronic
909973218 1:82015734-82015756 AAAATGATGAAATGGAGATCTGG + Intergenic
916265147 1:162883084-162883106 CAAGTGATGAGCTGGAAATCTGG - Intergenic
920579008 1:207087451-207087473 CAAGTGATCATATGGATTTTGGG + Intronic
921446890 1:215257281-215257303 CAAGTGATCAACTGGCTGTCAGG + Intergenic
921842808 1:219846585-219846607 CTAGTGCTGAAATGGATTTAGGG + Intronic
922271261 1:224037209-224037231 CAAGTGTTGACATGGATGTGGGG + Intergenic
1064500720 10:15970126-15970148 CAAGTAATGAAACAGTTCTCAGG + Intergenic
1065275696 10:24083397-24083419 CAAGAGATGAAATAAATTTCTGG - Intronic
1065289246 10:24213775-24213797 CCAGTGATGAAGAGGATTTCTGG - Intronic
1066003415 10:31125547-31125569 CAAGTGATGCAATGGAAGTTGGG - Intergenic
1066311400 10:34200458-34200480 CAAGTCAGGAAATGAATCTGTGG + Intronic
1066499364 10:35974810-35974832 GAAGCGATGAAATGGAACTTTGG + Intergenic
1067044818 10:42979586-42979608 AAGGTGATCAAATGGAGCTCCGG - Intergenic
1068891661 10:62154661-62154683 TAAATGATGAAATGGATCAAGGG + Intergenic
1069049661 10:63779044-63779066 CAACTCATGGACTGGATCTCTGG + Intergenic
1069204668 10:65666819-65666841 CAAGTGACATAATGGATCTGAGG + Intergenic
1070022280 10:72598646-72598668 TAAGTGATTATATGCATCTCAGG - Intronic
1071231417 10:83590854-83590876 AAAGAGAAGAAATGGAACTCAGG - Intergenic
1078175630 11:8967595-8967617 CCAGTGATCAAATAGCTCTCTGG + Intergenic
1086864090 11:91959303-91959325 CAAGAGCTGAAATGGATTTAGGG + Intergenic
1088048816 11:105485603-105485625 CAAATGAGGCAATGGACCTCAGG + Intergenic
1092732117 12:11544789-11544811 CATGTGAGGTCATGGATCTCAGG - Intergenic
1093007324 12:14064616-14064638 TAAGTGATCTAATGGATCTGAGG + Intergenic
1093195342 12:16123932-16123954 CAAGAGATGAAGAGCATCTCTGG + Intergenic
1093725802 12:22507028-22507050 GAACTGATGAAATGGGTCTTTGG - Intronic
1094720587 12:33059103-33059125 AAAGGGATGAAATGCATCTCAGG - Intergenic
1097069398 12:56343801-56343823 TAAGTGATGAGATGGAGCTATGG - Intronic
1100921671 12:99495020-99495042 CAAGGGAGGAAAAGTATCTCAGG + Intronic
1102666206 12:114575454-114575476 CAAGACATGAAATGTATTTCTGG - Intergenic
1107379345 13:39839311-39839333 CAAGTGATAAAATGGAGATTTGG - Intergenic
1107761090 13:43679665-43679687 TAAGTGTTGAAAAGGATCTTAGG - Intronic
1110651579 13:77948378-77948400 CAAATAAAGACATGGATCTCAGG - Intergenic
1111539670 13:89654252-89654274 CAAGTGATGAAAGGTTACTCTGG + Intergenic
1112953119 13:105027405-105027427 CAATTGATAAACTGGAGCTCAGG - Intergenic
1113706481 13:112436655-112436677 CAAGTGATGAACTGGCTTACAGG + Intergenic
1119557596 14:75565602-75565624 GAAGGGAGGAAATGGATATCTGG - Intergenic
1120703051 14:87719278-87719300 CAAGTGATAATATAAATCTCAGG + Intergenic
1121779091 14:96610370-96610392 CAAGTGAGGAAAGGGACCTGAGG + Intergenic
1125454725 15:39845403-39845425 CAAATGAAGAAATGAATTTCAGG + Intronic
1125976660 15:43959392-43959414 CAAGAAATCAAATGGATCTGAGG + Intronic
1126881649 15:53105467-53105489 CAAGTGCTGAAATGGAAATCAGG + Intergenic
1128107978 15:65058376-65058398 CAAGTGAAGAAAGCGAGCTCTGG + Intronic
1132770508 16:1559820-1559842 TAAGGGAGGAAAAGGATCTCAGG + Intronic
1138300983 16:55929512-55929534 GAAGTGATGACTTGGATCTGTGG - Intronic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1139008023 16:62597331-62597353 CATGTTAGGAAATGGATCACTGG - Intergenic
1140059487 16:71555571-71555593 CAAGTGATGACAAGGAACACAGG + Intronic
1142183397 16:88682560-88682582 TATGTGTTAAAATGGATCTCTGG + Intronic
1144486587 17:15670571-15670593 CAAGTGAGGAGATGGAGATCTGG - Intronic
1144914433 17:18711716-18711738 CAAGTGAGGAGATGGAGATCTGG + Intronic
1146216696 17:30982160-30982182 CTAGTGCTGAGATGGGTCTCTGG - Intronic
1150720775 17:67612469-67612491 CAGGTGATGAAATGGAGGCCTGG + Intronic
1153734489 18:8050864-8050886 CTAGATATGAAATGGAACTCAGG - Intronic
1156871552 18:41951699-41951721 CAATTGAAGAAATGGAGGTCAGG + Intergenic
1156927798 18:42604051-42604073 GAAGTGAAGAATTAGATCTCCGG - Intergenic
1157797778 18:50591116-50591138 CAAATGAGGAAAGGGGTCTCTGG + Intronic
1160307782 18:77756479-77756501 CAAATCATGAAATTGATCTATGG + Intergenic
1162702334 19:12526075-12526097 CATGTGATGACATGGATTTTGGG - Exonic
1163103678 19:15111418-15111440 CCAGTGATGACATTGATATCGGG - Exonic
1167309806 19:48730460-48730482 CATGTTAAGAAATGGGTCTCTGG - Intronic
930392603 2:50781049-50781071 CAAGTAATGAACTTCATCTCTGG - Intronic
933137814 2:78759340-78759362 AAAATGAGCAAATGGATCTCAGG + Intergenic
933469418 2:82702334-82702356 CAAGTGAGAAAATGTATTTCAGG + Intergenic
936959166 2:118055658-118055680 CAAGTGAGAAAATGTATCTATGG - Intergenic
937854627 2:126663454-126663476 GATGTGAGGAAATGGAGCTCCGG - Intronic
941453776 2:165692055-165692077 TAAGTGATGACATGAATCTGAGG - Intergenic
944458951 2:199924265-199924287 CAAGTGATGATATGCACCTGTGG + Intronic
944843637 2:203646889-203646911 TAAGTGACGAAATCGCTCTCAGG + Intergenic
946484032 2:220083901-220083923 CAAATGCTGAAATGGATGCCAGG - Intergenic
948362427 2:237432573-237432595 CAAGTGATGACACGGAGGTCGGG - Intergenic
949082307 2:242112466-242112488 CAAGTGTTGACATGGATGTGGGG - Intergenic
1168954622 20:1826327-1826349 AAAGTGAGGAGATGGATCACTGG - Intergenic
1168972891 20:1942920-1942942 AAAGTGATGGAAGGAATCTCAGG - Intergenic
1170197227 20:13701969-13701991 AAAGTTCTGAAATGGATTTCTGG - Intergenic
1170452300 20:16496050-16496072 CAAGTGATGAAATGAAGGACTGG - Intronic
1174457034 20:50656299-50656321 CAAGTGGTGACATGATTCTCAGG - Intronic
1182754838 22:32670814-32670836 TAAGTGATGAGATGAATGTCTGG + Intronic
954951352 3:54477183-54477205 AAAGTGATGAGATGGGTATCTGG + Intronic
956618873 3:71200180-71200202 CAAGTGCTGAATCGGCTCTCTGG - Intronic
957274414 3:78072577-78072599 CTGTTGATGAAAGGGATCTCAGG + Intergenic
960457738 3:117893831-117893853 CAAGTGATGAATGGAATCTAAGG + Intergenic
960987258 3:123289025-123289047 CAAGTTATGAAATGGGTCAGTGG - Intronic
964070033 3:152620223-152620245 AAAGTGAAGGAATGGATCTAGGG + Intergenic
964071311 3:152636866-152636888 CAAGTGATTAAAGACATCTCTGG - Intergenic
964457785 3:156886658-156886680 CTAGAGATGAAATGGATTTAGGG - Intronic
969410242 4:7023519-7023541 CAGGTGGTGAAATGGTTTTCTGG + Intronic
970589648 4:17548071-17548093 CCAGGGATGAGGTGGATCTCAGG + Intergenic
971982666 4:33773757-33773779 CAAGTAAAGAAATGGATTTTTGG + Intergenic
973802259 4:54490962-54490984 CAAATGATAAAATGCATCACTGG - Intergenic
975902914 4:79174067-79174089 CAAATGATGAACAGGATCACAGG - Intergenic
976824653 4:89247896-89247918 TATCTGAGGAAATGGATCTCCGG + Exonic
977177567 4:93835189-93835211 TGAGTGAAGAAATGCATCTCTGG - Intergenic
977519041 4:98057439-98057461 CAAGTGAAGGAAAGAATCTCAGG + Intronic
977929621 4:102736986-102737008 CTAGAGCTGAAATGGATTTCAGG + Intronic
978342512 4:107733641-107733663 CAGGTGATGAAAAGGATGTGTGG - Intergenic
982128852 4:152208719-152208741 CAAGTGCTGAAAGGGATGTGGGG - Intergenic
982631147 4:157830905-157830927 CTTGTGATGAAATGGGTTTCTGG - Intergenic
985380441 4:189389193-189389215 CAAATGATAAAATGCATGTCAGG - Intergenic
986443307 5:7799662-7799684 TACGTGAGGAAATGGAGCTCAGG - Intronic
989985212 5:50689404-50689426 CAAGTGATTAAATGGAGCAGAGG - Intronic
1000426828 5:161100963-161100985 CAAGAGATGAGATGGATATATGG + Intergenic
1001939706 5:175731796-175731818 CAAGTGATGACATAGATTCCAGG + Intergenic
1004849508 6:19683897-19683919 CAAGAGATGGAATCGATCTAAGG - Intergenic
1004979754 6:21010462-21010484 CAAGTGATGAAATGGATCTCTGG - Intronic
1005139540 6:22612319-22612341 CAAGTTATGAAATGTTTCTTCGG + Intergenic
1015485241 6:133762694-133762716 AAACTGAGGAAATGGAACTCAGG - Intergenic
1021715137 7:23454800-23454822 CAAGTGATGTAATGAACCTTTGG - Intronic
1021946070 7:25728566-25728588 CAAGTGAGGAAATGGCTCGGTGG - Intergenic
1024960030 7:54964438-54964460 AAAGTTATTAAATGGATCTATGG + Intergenic
1035739928 8:1919359-1919381 CAAGTGATGAAGCTGTTCTCTGG + Intronic
1040989681 8:53336219-53336241 CTAGAGATGAAATGGATTTAGGG - Intergenic
1044670357 8:94674139-94674161 CAGGTGATGAAATGCAAGTCAGG + Intronic
1045558286 8:103236237-103236259 AAAGTGATGAAGTGGAGCTATGG - Intergenic
1045996684 8:108370808-108370830 AAATTAATGAAATGGATTTCTGG - Intronic
1048166330 8:132064835-132064857 GAAGTGTTGACATGGATCCCAGG + Intronic
1055717184 9:79130988-79131010 CAAGTGATGAAACTGGTCTAGGG - Intergenic
1055812275 9:80162922-80162944 CCACTGATGAAATGCAGCTCTGG - Intergenic
1056900305 9:90592854-90592876 CTAGTTAAGAAATGGATCTATGG - Intergenic
1062407801 9:136405298-136405320 CCTGTGATGGAATGGGTCTCAGG + Intronic
1186555465 X:10553610-10553632 CAAGTGATGAAATGATTTTAGGG + Intronic
1187852276 X:23602829-23602851 CAAGTGATGACAAGAATCTGGGG + Intergenic
1192588484 X:72339822-72339844 CATGTGATGATATGGATGGCTGG + Intronic
1199564585 X:149201201-149201223 CTAGTGCTGAAATGGATTTAGGG - Intergenic
1201631792 Y:16077888-16077910 CAAGTTCTGCAATGGTTCTCAGG - Intergenic