ID: 1004982229

View in Genome Browser
Species Human (GRCh38)
Location 6:21038269-21038291
Sequence TTCTGTGTGTGGAGGCCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004982229 Original CRISPR TTCTGTGTGTGGAGGCCAGT AGG Intronic
900533687 1:3167012-3167034 TTCTGGGGATGGAGGGCAGTTGG - Intronic
901590676 1:10339176-10339198 TTCTGTGTGTCGAGACCTGTGGG + Intronic
901810205 1:11763075-11763097 TGGTGTGTGTGGAGGACAGTGGG + Intronic
902868457 1:19296860-19296882 TTGGGTATCTGGAGGCCAGTGGG - Intergenic
903456412 1:23490261-23490283 TTCTGGGAGTGCAGGCCAGTAGG + Intergenic
903680720 1:25094978-25095000 GTCTGTGTGTTGAGGGCAGGTGG - Intergenic
904286876 1:29458744-29458766 GTCTCTGTGTGGACCCCAGTTGG + Intergenic
905303875 1:37004442-37004464 TTCGGGTTGTGGAGGGCAGTGGG + Intronic
906892910 1:49738049-49738071 GTCAGTGTGTGCAGGACAGTGGG + Intronic
907510164 1:54952080-54952102 TTCTGGGAATGCAGGCCAGTAGG - Intergenic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
907830482 1:58060110-58060132 TTCTGTGTGGGGAGAGCAGCAGG + Intronic
910357382 1:86375970-86375992 TTTTGTGTGTGGAGGCGGGGGGG + Intronic
911676958 1:100668976-100668998 TACTGTGGGTGCAGGACAGTGGG - Intergenic
915315766 1:155028215-155028237 TTATGTGTGTTGGGGCCAGGCGG - Intronic
916361816 1:163978700-163978722 TCCTGTTTGTGGAGCTCAGTGGG - Intergenic
917125097 1:171680280-171680302 TTCTGTGAGTGAAGTCCAATGGG + Intergenic
917976901 1:180245495-180245517 TGCTGTGTGAGGCGGCCACTCGG + Intronic
918783628 1:188734057-188734079 TACTGTCTGTGGAGGCCTGATGG + Intergenic
919930092 1:202215474-202215496 TTCTGTGTGTGGAGGTATGTGGG - Intronic
920899599 1:210094268-210094290 TACTGTGTGTTGAGGCTAATTGG + Intronic
921070896 1:211656806-211656828 TTTTGTAAGTGGAGTCCAGTGGG + Intergenic
921475097 1:215597287-215597309 TTCTGTGTGTGTGGGCGAGGGGG - Intronic
921581904 1:216905166-216905188 TTCTGTGTGTGATGGGCAGCCGG - Intronic
921725717 1:218521306-218521328 GTCTGTGTGTGGGGGCAAGAAGG + Intergenic
923729942 1:236540431-236540453 TCATGTGTGTGGAGACCTGTGGG + Intronic
924632888 1:245759186-245759208 TTCTCTATTTGGAGGTCAGTAGG + Intronic
1063685014 10:8228717-8228739 TTCTGTGTGTGGTAACCAGATGG + Intergenic
1063727810 10:8658109-8658131 TTGTGTGTGTGGAGGGGTGTGGG + Intergenic
1063805210 10:9631246-9631268 TGCTGTGTGAAGAGGCCAATTGG - Intergenic
1065790434 10:29255240-29255262 TTCTGTTTCTGGATGCCAGCTGG + Intergenic
1066783661 10:38979246-38979268 CTCTCAGTGTGCAGGCCAGTGGG - Intergenic
1067083303 10:43225238-43225260 GTCTGTGTGTGGGGGTCTGTGGG + Intronic
1069312587 10:67056664-67056686 TTTTGTGGGTGGAGGACTGTTGG - Intronic
1069713940 10:70508809-70508831 GTGTGTGTGTGCAGGCCTGTGGG + Intronic
1069713946 10:70508847-70508869 GTGTGTGTGTGCAGGCCTGTGGG + Intronic
1070764190 10:79047191-79047213 TCCAGTGGGTGGAGGTCAGTGGG + Intergenic
1073463840 10:103682229-103682251 CTCTGTGTGTCCAGGCCAATTGG + Intronic
1073505339 10:103982868-103982890 GTCTGGCTGTGGGGGCCAGTTGG + Intronic
1073575878 10:104622635-104622657 TTGTGTCAGTGGAGGCCAGTTGG + Intergenic
1074234592 10:111572706-111572728 TTTTCTGTGTGGAGTCCACTGGG + Intergenic
1074816342 10:117143650-117143672 TTCTGTGACTGGAAGCAAGTAGG - Intergenic
1075766754 10:124899282-124899304 TTCTGTGAGCGAAGTCCAGTGGG - Intergenic
1075942548 10:126404025-126404047 TTCTCTGTGTGGAGGCTTGATGG + Intergenic
1079947958 11:26767011-26767033 TCCTGGGTGTGCAGCCCAGTAGG - Intergenic
1080913600 11:36631144-36631166 TTCTGTGGGTGGAGGGCTGGGGG - Intronic
1080915670 11:36656227-36656249 TGATGTGTGGGGAGGCTAGTAGG + Intronic
1084411093 11:69006294-69006316 GTCTGTGGGTGGGGGCCAGCCGG - Intronic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1086611005 11:88755726-88755748 TTCTCTGTTTGGAGGCAAATGGG - Intronic
1087061487 11:93983147-93983169 TTCTGGGTGTCAAGCCCAGTAGG + Intergenic
1091254455 11:134171811-134171833 TGCTGTGTTTGGAGGACAGCCGG - Intronic
1091619670 12:2076847-2076869 TGCTGTGTGTGAAGGACACTGGG + Intronic
1091671581 12:2456010-2456032 TACTGTGTCTGGAGGTCAGTGGG - Intronic
1091786817 12:3247934-3247956 TTCTGTGTGTGCATGCCAGTGGG + Intronic
1091803335 12:3338930-3338952 TTCTGTGTTAGGAGTCTAGTGGG - Intergenic
1092170365 12:6370485-6370507 TTCTGTGAGAGGAGGCCACCGGG - Intronic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1100406250 12:94275134-94275156 TTCTGAGTAGGGAGGACAGTGGG - Intronic
1100426820 12:94495230-94495252 TTCTGGGAGTGCAGCCCAGTAGG - Intergenic
1102745912 12:115248984-115249006 TTTTGTGGGAGGAGCCCAGTGGG - Intergenic
1104380517 12:128303772-128303794 TTCTGATTGTGTTGGCCAGTAGG + Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104717873 12:131028606-131028628 TTCTGTGTCTGCAGTGCAGTAGG + Intronic
1104727419 12:131086497-131086519 TTCTGTGTGCAGAGGCCTGATGG + Intronic
1105543997 13:21338813-21338835 TTGTGTCTGTGGAGGCAGGTCGG + Intergenic
1107681417 13:42855738-42855760 TTTTACGTGTGGAGGCCAGGAGG - Intergenic
1109239302 13:59864102-59864124 TTCTGTGTGTTTGGGTCAGTTGG + Intronic
1109906343 13:68846651-68846673 TTAAGAGTGTGGAGGACAGTTGG + Intergenic
1110546750 13:76764734-76764756 TTGTGTCAGTGGAGCCCAGTGGG - Intergenic
1112135246 13:96570942-96570964 TTCTGTGTGTGGATGAGAGAAGG + Intronic
1112553256 13:100442914-100442936 TGTTTTGTGTGAAGGCCAGTTGG + Intronic
1114600521 14:23952669-23952691 GTCTGGCTTTGGAGGCCAGTGGG + Intergenic
1114604755 14:23987813-23987835 GTCTGGCTTTGGAGGCCAGTGGG + Intronic
1115403156 14:32986495-32986517 TTTTGTGTGTTGATGTCAGTGGG + Intronic
1115792932 14:36900009-36900031 TCCTTTGTGTTTAGGCCAGTTGG - Intronic
1115876295 14:37865576-37865598 TTCTGTGTGGGCAGGCGAGCTGG - Intronic
1116855296 14:49946691-49946713 TTCTGAGTGAGGAGGCCTGTGGG + Intergenic
1117322397 14:54636407-54636429 TTCTGAGTGTGGAAGCCAAAGGG - Intronic
1117459701 14:55933124-55933146 TTTTTTGGGTGGAGGGCAGTGGG + Intergenic
1119893777 14:78202612-78202634 TTCTATGTGTGTTGGCCAGGTGG + Intergenic
1121183232 14:91945322-91945344 TTGTGGGTGTGGATGCCAGATGG + Intronic
1121997659 14:98616359-98616381 TGCAGTGTGTGGAGCCCTGTGGG - Intergenic
1122276768 14:100594690-100594712 TTCCATGTGTGGAGCCCAGAGGG - Intergenic
1124577521 15:30922991-30923013 TTCTTTGTGTGGCCGCCAGCAGG + Intronic
1125349653 15:38753625-38753647 TTCTGTGAGTGAAGTCCAATAGG - Intergenic
1127110907 15:55669396-55669418 TGATGTGTCTGGAGGGCAGTAGG - Intronic
1128677955 15:69625529-69625551 CTCTGTGTGTGCTGGCCACTCGG - Intergenic
1129101213 15:73265835-73265857 TTCTGGATTTGGAGGCCACTTGG + Intronic
1129172780 15:73818061-73818083 TGGTGTTTGTGGAGGCCAGGTGG + Intergenic
1129291477 15:74571457-74571479 TTCAGTGTGTCCAGGCCACTGGG + Intronic
1129762632 15:78139483-78139505 TTCTGTGTTTGGAGGATTGTTGG + Intronic
1132501424 16:286214-286236 TTCTGTGTGGGGGGGGCGGTGGG - Intronic
1132944200 16:2523618-2523640 CTCTGTGTGGGGAGGGCTGTGGG - Intronic
1133417623 16:5618837-5618859 TGCTGTGTCTGGATACCAGTGGG + Intergenic
1133511534 16:6462699-6462721 TTTTGTGTGTGGGGGGCGGTGGG - Intronic
1136143449 16:28301651-28301673 TTCTGTAGATGGAGGCCATTTGG - Intronic
1136565784 16:31069339-31069361 CTCTGTGGGTAGAGCCCAGTGGG - Intronic
1137384385 16:48028151-48028173 TCCTGTGCGTGGTGGCCAGAGGG + Intergenic
1137660898 16:50205197-50205219 TTCTGTGTGGGGCGGGCAGAGGG + Intronic
1139348157 16:66317817-66317839 TTCTGTGCCTGGAGGTTAGTGGG - Intergenic
1139958370 16:70704124-70704146 GGCTGTGTGTGGATGCCAGGTGG - Intronic
1140127133 16:72127050-72127072 TTCTGAGTCTGGAAGCCAGAGGG + Intronic
1144891113 17:18494843-18494865 GTCAGTTGGTGGAGGCCAGTGGG - Exonic
1144946839 17:18973676-18973698 TTCTGTGTGTTGAGACCATAGGG + Intronic
1145141111 17:20449475-20449497 GTCAGTTGGTGGAGGCCAGTGGG + Intronic
1145809310 17:27755177-27755199 GTCAGTTGGTGGAGGCCAGTGGG - Intergenic
1151201178 17:72469131-72469153 TTAGGTGCGTGGAGGCCAGTGGG - Intergenic
1152805251 17:82352585-82352607 TTCTGTGTGTCCAGGCCATGTGG + Intergenic
1153638651 18:7135570-7135592 TTTTCTCTGTGGAGGTCAGTTGG + Intergenic
1154327588 18:13402902-13402924 TTTTGATTGTGAAGGCCAGTGGG - Intronic
1155509473 18:26562407-26562429 TTTTGTGTGTGAAGCCCGGTGGG + Intronic
1159006123 18:63014134-63014156 TTCTGTGTGTGGTGTGCATTAGG + Intergenic
1159070162 18:63613947-63613969 GTCTGTGTGGGGAGACCAGGAGG - Intergenic
1160159224 18:76458836-76458858 TTGTGTGTGTGCATGCCTGTAGG + Intronic
1160332451 18:78006964-78006986 TTATGTTTGTGGAAGCCGGTGGG - Intergenic
1160416581 18:78716292-78716314 TGCTGTGTGTGGAGGCCTCTGGG - Intergenic
1160956021 19:1692036-1692058 CTCTGTGTGTGGAGACGGGTGGG + Intergenic
1161083645 19:2323830-2323852 GTCAGTGTGTAGAGACCAGTGGG + Intronic
1161422884 19:4185301-4185323 GTTTGTGGGTGGTGGCCAGTGGG + Intronic
1164745645 19:30610754-30610776 GTGTGTGTGTGGAGGCGGGTGGG + Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1167710472 19:51107491-51107513 TGCTGTGTGGGGAGGACTGTTGG + Intronic
926296753 2:11574477-11574499 GCCTGTGGGTGGAGGGCAGTGGG + Intronic
927000116 2:18786132-18786154 TTCTCTGTGTGGCGGGCGGTGGG - Intergenic
928416671 2:31098361-31098383 TTCTGTATGTGGAGGACAAGAGG + Intronic
928593907 2:32842804-32842826 TTCAGTGTGTTGAGTCCAGTAGG - Intergenic
928661066 2:33502286-33502308 TTCTGTGTGTGGAGGTGGGTGGG + Intronic
929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG + Intronic
930033487 2:47072014-47072036 TTTTGTGTCTGGCGGCCCGTCGG + Intronic
930091501 2:47534520-47534542 TTCTGTGTGTGGGGGCGGGGGGG - Intronic
931251116 2:60531228-60531250 GTCTGTGTGTGCAGGACCGTCGG - Intronic
931366854 2:61626733-61626755 TTCTGGGTGTGGGGGACAGCAGG - Intergenic
933188372 2:79304052-79304074 TGCAGGGTGTGGGGGCCAGTGGG + Intronic
938724212 2:134092401-134092423 TGCTATGTGGGGAGGGCAGTGGG - Intergenic
939129513 2:138217529-138217551 ATATGTGTGTGGAGGGCAGTGGG - Intergenic
939695080 2:145313438-145313460 TTTTGTGGGTGGAACCCAGTGGG - Intergenic
941427762 2:165369654-165369676 GTGTGTGTGTGGAGGCGGGTGGG - Intronic
944652064 2:201840569-201840591 TTGTGTGTGTGTAGGCCTGCTGG + Intronic
945214103 2:207414875-207414897 TTCAGTGTGGGGAAGACAGTTGG + Intergenic
947948942 2:234131055-234131077 TCATGTGTGTGGAGGGCAGTGGG + Intergenic
947994377 2:234514944-234514966 TTCTGTGTGTGGTAGGCGGTGGG + Intergenic
948426074 2:237887157-237887179 TCCTGTGTGGGGAGGGCAGTGGG + Intronic
1169910681 20:10645283-10645305 TTCTGTGGGAGGGGGCCACTGGG - Intronic
1170478892 20:16745473-16745495 TTCTGTCTGTGGAGGCATCTTGG + Intergenic
1173151769 20:40572213-40572235 TTCTGTGTCTTGAGGGCAATGGG - Intergenic
1173263101 20:41453712-41453734 TACTGTGTGTGCAGGACACTGGG - Intronic
1174285679 20:49471313-49471335 TGCTGTGTGTGGAGACCAGACGG + Intronic
1175460129 20:59146185-59146207 TTGTGTGTGTGGAGGGTGGTGGG - Intergenic
1175618525 20:60423736-60423758 TGCAGTGTGTAGAGTCCAGTGGG + Intergenic
1176127089 20:63480464-63480486 TCCAGTGGGTGGAGGCCAGGGGG + Intergenic
1176365469 21:6030108-6030130 TTCATTCTGTTGAGGCCAGTGGG + Intergenic
1177038622 21:16077266-16077288 CTCTGTGTTTGGGGGCCACTAGG + Intergenic
1179758049 21:43508437-43508459 TTCATTCTGTTGAGGCCAGTGGG - Intergenic
1180953795 22:19732353-19732375 TGCTGGGTGTGGGGGCCACTGGG - Intergenic
1182116334 22:27758548-27758570 TTCTGTGTTTGGTGGCCTGTTGG - Intronic
1182747926 22:32619943-32619965 TCCTGTGTTTGGAGGTCAGCTGG - Intronic
1184812402 22:46844992-46845014 GTCTGTGCCTGGAGTCCAGTGGG + Intronic
949112919 3:284437-284459 TTGTTTGTGTGGAAGCCACTGGG + Intronic
951966338 3:28389775-28389797 TTCTGATGGGGGAGGCCAGTGGG + Intronic
952956642 3:38561941-38561963 CTCTGTCTGTGATGGCCAGTGGG - Intronic
953691573 3:45124359-45124381 TTCTGGGTGTGGTTGCCTGTGGG + Intronic
954131279 3:48562277-48562299 TTCTCTGTGTGGTGGCCTATGGG + Exonic
955692908 3:61607670-61607692 TTCTCTGTGGAGAGGCCAGGAGG + Intronic
956453007 3:69392647-69392669 TTCTGTGTGTGAAGGCCCCATGG - Intronic
956657755 3:71568465-71568487 TTCTGTATGTGGGGCCCTGTGGG - Intronic
956701785 3:71965262-71965284 TTCTGCTTGTTTAGGCCAGTGGG + Intergenic
956743310 3:72291656-72291678 TGCTGTGTGTGGAGTCCTGTGGG + Intergenic
957293437 3:78306693-78306715 CTCTATGTGTGGAGGCCTGATGG + Intergenic
959338977 3:105103697-105103719 TTCTGTAAGTGAAGTCCAGTGGG + Intergenic
962427587 3:135285732-135285754 TTCTGTGGGTGTAAGCAAGTTGG - Intergenic
962533073 3:136301526-136301548 CTGTGTGTGTGGAGGTCCGTGGG + Intronic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
964008992 3:151866951-151866973 TTCTGTGTTTGGAGGTCCTTTGG + Intergenic
964843028 3:161015047-161015069 TTAGGTGTGTGTAGGGCAGTTGG + Intronic
966134752 3:176685748-176685770 TTCTTTAAGTGGAGGCCAATGGG + Intergenic
966183481 3:177207595-177207617 TTCTGTGTGTGTGGGCGGGTTGG + Intergenic
966749840 3:183311471-183311493 CTCTGTATGTGGATGCCAGACGG + Intronic
967844886 3:194035538-194035560 TTGTGTGGGAGGAGGGCAGTGGG - Intergenic
968360694 3:198144803-198144825 TTCTCTGTGTGGATGCAGGTGGG + Intergenic
970435218 4:16026927-16026949 TTCTTTCTGTGGACTCCAGTTGG + Intronic
970469462 4:16362237-16362259 TTATGGGTCTGGTGGCCAGTAGG + Intergenic
971711413 4:30118348-30118370 TTCTCAGTGTGCAGGCCAGGTGG - Intergenic
973104960 4:46324105-46324127 TGCGGTGGGTGGAGGCAAGTGGG - Intronic
973150707 4:46884158-46884180 TTATGTGTGAGGGGGCCAGTTGG + Intronic
978227514 4:106355368-106355390 CTCTCTGTGTGCAGGCCAGTTGG - Intergenic
980972584 4:139580947-139580969 TTCTGTGTGTGCAGCACAATTGG + Intronic
983269933 4:165549454-165549476 CTGCGTCTGTGGAGGCCAGTGGG + Intergenic
985733935 5:1566383-1566405 GTGTGTGTCTGGAGGCCAGGTGG - Intergenic
988922254 5:35954235-35954257 TGCTGGGTGTGGTGGCCAGGTGG - Exonic
989170483 5:38467405-38467427 GTCTGTGTGTGGACACCAGCCGG - Intergenic
993812491 5:92499160-92499182 TTCTGTGTCAGGGGACCAGTGGG - Intergenic
995587547 5:113663843-113663865 TTCTGTGTATGGGGTCCATTTGG - Intergenic
997399489 5:133591470-133591492 TATTGTGGGTGGAGGACAGTTGG - Intronic
997639909 5:135442369-135442391 TTCTGTAAGTGGAAGGCAGTGGG + Intergenic
998360021 5:141577235-141577257 TTCTGTTTTTGGAGGGGAGTAGG - Intronic
998369858 5:141654014-141654036 GTCTGTGTTGGAAGGCCAGTGGG + Exonic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
999302499 5:150499910-150499932 CTCTGTGTGCTGAGGCCAGCAGG + Intronic
999891680 5:155984891-155984913 TCCTGTGTGTTTAGTCCAGTTGG - Intronic
1001571772 5:172735053-172735075 TTGTGTGTATGGGGGCCAGTTGG + Intergenic
1001656741 5:173356488-173356510 TTCTGTCTGTGGGGCCCTGTGGG + Intergenic
1004408514 6:15358552-15358574 TTCTGTTTCTTGAAGCCAGTAGG + Intronic
1004982229 6:21038269-21038291 TTCTGTGTGTGGAGGCCAGTAGG + Intronic
1006626766 6:35403138-35403160 TTCTGTCTGTGGAGGTCCCTTGG + Intronic
1006985162 6:38171089-38171111 TTCTGTGTACTGAGGCCACTTGG - Exonic
1007669126 6:43536831-43536853 TTCTGTGTGTGGTGGCTGGTAGG + Intronic
1007805073 6:44437152-44437174 TTCTGTGTGTGGATGGGTGTTGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1011112363 6:83853084-83853106 TTCCGTGTGAAGAGGCCAGGAGG - Intergenic
1011593858 6:88997344-88997366 TTCTGTGTGTGAAGACTGGTGGG + Intergenic
1011756933 6:90509348-90509370 TTTTGTGTGTGGGGGTTAGTGGG + Intergenic
1012096593 6:94970236-94970258 TTCTGGGGGTGGAGGTCAGGAGG + Intergenic
1016310997 6:142733558-142733580 TTCTATGTGGGGAGGTGAGTAGG - Intergenic
1017691378 6:156968943-156968965 TTCTGTGAGTGGAGCCCAGGTGG + Intronic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1019259311 7:71829-71851 TTCTCTGTGTGGATGCAGGTGGG - Intergenic
1023090601 7:36614455-36614477 TTATGTGAGTGAAGTCCAGTGGG + Intronic
1023116170 7:36864721-36864743 TGTGGTGTGTGGAGGCAAGTAGG - Intronic
1024374258 7:48619690-48619712 TCCTGGGTTTGGAGGCCACTTGG - Intronic
1024433808 7:49324470-49324492 TCCTGGGAATGGAGGCCAGTAGG + Intergenic
1025224116 7:57141915-57141937 ATCTGTGTGTTGAGCCCAGAAGG + Intergenic
1025721947 7:64025156-64025178 ATCTGTGTGTTGAGCCCAGAAGG - Intergenic
1025745545 7:64239495-64239517 ATCTGTGTGTTGAGACCAGAAGG - Intronic
1028947696 7:96599533-96599555 TGCTGTGTGTTGAAGCAAGTGGG - Intronic
1028975148 7:96904512-96904534 TTTTGTGTGTGTGGGCCAGGGGG - Intergenic
1029253205 7:99251436-99251458 TTCTTGGTGTTGAGGCCAATTGG - Intergenic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1035438602 7:158878214-158878236 TGCTGTGTGGGGAGGCCAGGAGG + Intronic
1035579911 8:732880-732902 TTCTGGGTGGGGGGGCTAGTTGG + Intronic
1036614439 8:10377805-10377827 TGCTGGGTGTGGAGGCAAGTGGG + Intronic
1036615367 8:10383390-10383412 TTCTGTGTGTGAAGGAGAGACGG + Intronic
1038579857 8:28738618-28738640 TGCTCTGTGTGGTGGGCAGTGGG - Intronic
1039318580 8:36401520-36401542 TTCAGTGTTTGGAGGCCTGTGGG + Intergenic
1040468409 8:47716405-47716427 TTCACTGTGTTGAGGCCATTTGG + Intronic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1045951227 8:107853960-107853982 TTCTGTGTGTAAAAGCCAGGAGG - Intergenic
1046841395 8:118861759-118861781 TTCTGTATGTGGAGTCAAATAGG + Intergenic
1047055152 8:121155685-121155707 TTCAGATTGTGGAGGGCAGTGGG + Intergenic
1047230856 8:122996639-122996661 ATGTGTGTGTGGAGGGCTGTGGG - Intergenic
1048306885 8:133290643-133290665 TTCAGCGTGTGGAGGTCAGCTGG + Intronic
1048786030 8:138051339-138051361 TTGTGTGTGTGGCGGGGAGTTGG + Intergenic
1052169320 9:25374462-25374484 TTTTGTGGGAGGAGCCCAGTGGG - Intergenic
1055254280 9:74348802-74348824 TTAAGTGTGTGTAGTCCAGTGGG + Intergenic
1055294646 9:74821685-74821707 GTTTGTGTGTGAAGGCCAGGAGG + Exonic
1058364176 9:104188267-104188289 TTCTGTGAGTAGAGGCCACATGG - Intergenic
1059510328 9:114839391-114839413 CTGTCTGTGTGGAGGCCAGAGGG + Intergenic
1059859702 9:118446335-118446357 TTCTGTGGGGGGAAGCCAGCTGG - Intergenic
1060815464 9:126632837-126632859 TTCTGGGTGTGGGGCCCAGTGGG - Intronic
1061269287 9:129527929-129527951 TTCTGTGTGTAGAGGCTGCTAGG - Intergenic
1062635556 9:137488756-137488778 TGCTGTGGGTGGTGGACAGTTGG - Intronic
1185488668 X:501821-501843 TTCTGTGTGTTGTGTGCAGTAGG - Intergenic
1186497488 X:10023326-10023348 TTCTGAGAGAAGAGGCCAGTTGG + Intronic
1188809511 X:34635561-34635583 TTCAGTGTGTGGGGACCTGTAGG + Intronic
1192847613 X:74922873-74922895 TTATGTCTGGGGGGGCCAGTTGG + Intronic
1196867978 X:120086614-120086636 TTCTTTGTGGGGAGGCTAATTGG + Intergenic
1196875125 X:120149667-120149689 TTCTTTGTGGGGAGGCTAATTGG - Intergenic
1197934789 X:131729076-131729098 TCCGGTGTGGGGAGGACAGTAGG + Intergenic
1198208485 X:134492759-134492781 TTCTGTGTGTGTACACCAGGAGG + Intronic
1198621898 X:138521751-138521773 TTGTGTGTGTGAAAGGCAGTAGG - Intergenic
1198743648 X:139867436-139867458 TTCTGTGTGTGAATGGGAGTGGG - Intronic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic