ID: 1004987850

View in Genome Browser
Species Human (GRCh38)
Location 6:21102856-21102878
Sequence CTGGCAGGAAGCAGAAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 542
Summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 474}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004987850_1004987857 15 Left 1004987850 6:21102856-21102878 CCTACCTTTCTGCTTCCTGCCAG 0: 1
1: 0
2: 6
3: 61
4: 474
Right 1004987857 6:21102894-21102916 CTTAGGCTCTCTACCAGAAAGGG 0: 1
1: 0
2: 0
3: 6
4: 100
1004987850_1004987856 14 Left 1004987850 6:21102856-21102878 CCTACCTTTCTGCTTCCTGCCAG 0: 1
1: 0
2: 6
3: 61
4: 474
Right 1004987856 6:21102893-21102915 ACTTAGGCTCTCTACCAGAAAGG 0: 1
1: 0
2: 0
3: 5
4: 74
1004987850_1004987858 21 Left 1004987850 6:21102856-21102878 CCTACCTTTCTGCTTCCTGCCAG 0: 1
1: 0
2: 6
3: 61
4: 474
Right 1004987858 6:21102900-21102922 CTCTCTACCAGAAAGGGAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1004987850_1004987855 -2 Left 1004987850 6:21102856-21102878 CCTACCTTTCTGCTTCCTGCCAG 0: 1
1: 0
2: 6
3: 61
4: 474
Right 1004987855 6:21102877-21102899 AGTTGACAGGCTAACTACTTAGG 0: 1
1: 0
2: 0
3: 9
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004987850 Original CRISPR CTGGCAGGAAGCAGAAAGGT AGG (reversed) Intronic
900184831 1:1328165-1328187 CTGGCAGAAAGGAGAAAGGATGG - Exonic
900657445 1:3766512-3766534 CTGGAAGGAGACAGAAGGGTTGG - Intronic
901721440 1:11201522-11201544 TTGGCAAGAAGCAGAAAGCAAGG - Intronic
902388166 1:16087997-16088019 CTGGCAGGAAGGAGAAGGTTTGG - Intergenic
902716557 1:18276796-18276818 CTGGCAGGCAGCGGGAAGGGTGG - Intronic
902962520 1:19974935-19974957 CTGGGAGAAAGCAGGAAGGTTGG - Intergenic
903172504 1:21562922-21562944 ATGGCAGGAAGCAGGCAGCTAGG + Intronic
903499779 1:23794626-23794648 CTGGCTGGAGGCAGAGAAGTGGG - Intronic
904372250 1:30057191-30057213 CTGGCAGGAGGCAAAATGCTGGG - Intergenic
904639611 1:31914977-31914999 CTTGTAGGAGGCAAAAAGGTGGG - Intronic
904763685 1:32824511-32824533 CTCGCAGGGACCATAAAGGTAGG - Intronic
904882164 1:33708981-33709003 CAGGAAGGAAGGAGAAAGTTTGG + Intronic
905319725 1:37107309-37107331 CTGGGAGGAAGCAAAACAGTGGG + Intergenic
905357810 1:37396840-37396862 CTGGCAGGAAGGAGCCAGGCAGG - Intergenic
905474956 1:38219509-38219531 CAGGCAGGAAGAGGAAGGGTAGG + Intergenic
906077791 1:43064881-43064903 TGGGCAGGAAGCAGACAAGTTGG - Intergenic
906285964 1:44588103-44588125 CTGGCAGGAAGCAATCAGGCAGG + Intronic
906480216 1:46194652-46194674 CTGGCAGGAGGCAGGAATGAGGG + Intronic
907038194 1:51235406-51235428 CTGATGAGAAGCAGAAAGGTTGG + Intergenic
907196735 1:52693136-52693158 CTGACAGGGAGCAGAAGGGCTGG - Intronic
907777583 1:57533643-57533665 CTGCAAGGAAGCTGAATGGTAGG - Intronic
907870492 1:58438465-58438487 CAGGTAGGAAGCAGACAGCTGGG + Intronic
908102718 1:60807937-60807959 ATGGCAGGATGCAGTATGGTGGG + Intergenic
908220043 1:61996367-61996389 CTGGCAGCAAGCAGAAAGTCAGG - Intronic
910177121 1:84442948-84442970 CACCCAGGAAGCATAAAGGTTGG + Intergenic
912513465 1:110203593-110203615 CTCCCAGGAAGCAGGAAGCTGGG - Intergenic
912690498 1:111801224-111801246 CTGGGAGAAAGCGGGAAGGTGGG + Intronic
912945713 1:114082468-114082490 GTGGCAGGAAGCACAGAGGGGGG - Intergenic
913285005 1:117218007-117218029 CTGCAAGGAAGCAGCAAGGCTGG + Intergenic
913385261 1:118252236-118252258 AATGCAGGAAGCAGTAAGGTTGG + Intergenic
915459460 1:156061168-156061190 CTGTAAGGAAGCAGAGAGGACGG - Exonic
915472477 1:156134330-156134352 CTGGAAGGAAGCTGAGAGGTGGG - Intronic
915974991 1:160379563-160379585 CGGGGAGGAAGCCGAAAGGCAGG - Intergenic
916440292 1:164818373-164818395 CTGAAAGGAATTAGAAAGGTAGG - Intronic
916487962 1:165276050-165276072 CTGGCAGGAAGAAGAGGGGGAGG + Intronic
916836826 1:168554496-168554518 ATGCCTGGCAGCAGAAAGGTTGG - Intergenic
917767765 1:178242293-178242315 CAGGAAGGAAGCAGAAATATGGG - Intronic
919502612 1:198356151-198356173 CTGGCAGGAGGAAGAAGGCTTGG + Intergenic
919924491 1:202185407-202185429 GTGTCAGGGACCAGAAAGGTGGG + Intergenic
920362161 1:205426562-205426584 TTGGCAGGAAGCAGAAGGATGGG + Intronic
920540494 1:206774377-206774399 CTGCCAGGAAGCAGAGAGAAGGG + Intergenic
921625370 1:217373128-217373150 ATGGCAGGAGGCAGACAGGTAGG + Intergenic
921955092 1:220974008-220974030 CTGGGAGGATGCAGAAGGCTGGG + Intergenic
922447339 1:225708460-225708482 CTGGGTGGATGCAGAAAGGAAGG + Intergenic
922728825 1:227939647-227939669 CTGGCAGGAGGCAGGAAGGTCGG - Intronic
922985578 1:229863830-229863852 CAGGCTGGAAACAGAAAGGGAGG + Intergenic
923011101 1:230088272-230088294 GAGGCAGAAAGCAGAATGGTGGG - Intronic
924416257 1:243859788-243859810 CTAGCAGGAGGAAGAGAGGTTGG + Intergenic
924929886 1:248721265-248721287 TTGAAAGAAAGCAGAAAGGTGGG - Intronic
1063075524 10:2712789-2712811 CTAGCAGGAAGCAGTGAGGCAGG + Intergenic
1063920405 10:10926747-10926769 CTGTCAGCAAGGAGAAAGGTAGG + Intergenic
1065162325 10:22935639-22935661 CTGTCAGGAGGGAGAAAGATGGG - Intronic
1065881981 10:30044779-30044801 TTGGAGGGAAACAGAAAGGTAGG - Intronic
1065965595 10:30767929-30767951 CAGGCAGGAAGCAGAGAGCTAGG - Intergenic
1066062310 10:31735197-31735219 CTGGCAGGGAACAGACAGGAGGG - Intergenic
1066143875 10:32536192-32536214 CAGGCAGGAAGCAGAGAGGGTGG + Intronic
1066716246 10:38289519-38289541 CTAGTAGTAAGCAGAAAAGTGGG + Intergenic
1067041549 10:42955743-42955765 CTGGATGGACACAGAAAGGTGGG + Intergenic
1067045096 10:42981049-42981071 CTGGCAGGGTGAGGAAAGGTGGG - Intergenic
1067498845 10:46784489-46784511 CTAGCAGGACACAGAAAGCTAGG - Intergenic
1067595800 10:47555884-47555906 CTAGCAGGACACAGAAAGCTAGG + Intergenic
1068961088 10:62867324-62867346 CTGCTAGGCAGCTGAAAGGTTGG + Intronic
1070338119 10:75472867-75472889 CTAACAGGAAGCAGGAGGGTGGG + Intronic
1070970821 10:80565770-80565792 CTGGCAGGAAGAAGAAGGTCGGG + Intronic
1071556244 10:86604135-86604157 ATGTCAGGAAGCAGAAATGTAGG - Intergenic
1071985942 10:91050451-91050473 CTGGCAGTAAGCAGAAGGCAGGG + Intergenic
1072690649 10:97570571-97570593 CTGGAAGGCAGCAGCAGGGTGGG - Exonic
1073278737 10:102335564-102335586 CTTGTAGGAAGCAGTAAAGTCGG + Intronic
1073398918 10:103241099-103241121 CTGGCCCGAAGCAGAAATTTTGG + Intergenic
1073849340 10:107596165-107596187 AAGGCAGGAAGAAGAAAGGAAGG - Intergenic
1074396833 10:113104970-113104992 TTGGCAGGAAGCAGAAAAGAAGG + Intronic
1074856358 10:117476947-117476969 CAGGCAAGAAGCAGAAAGACAGG - Intergenic
1075051223 10:119183689-119183711 CTGGCTAGAAGCAGAGAGGTAGG + Intergenic
1075214107 10:120516947-120516969 CCTGAAGGAAACAGAAAGGTAGG - Intronic
1075630635 10:123998753-123998775 CTGGCAGGATCTAGAAAGGTGGG - Intergenic
1075713419 10:124542709-124542731 CTGGAAGGAGGCAGAGAGGTGGG - Intronic
1076235466 10:128860864-128860886 GTGGCAGGAAGCAGGAATGCAGG - Intergenic
1077084117 11:739578-739600 GAGGCAGAAAGCAGAATGGTGGG - Intergenic
1077146813 11:1050164-1050186 CTGACAGGCAGCAGGAAGGCAGG - Intergenic
1077181106 11:1217253-1217275 CTGGCTGGGAGCAGAATGGCTGG - Intergenic
1077225148 11:1436331-1436353 CTTGGAGGCAGGAGAAAGGTGGG - Intronic
1077509393 11:2948430-2948452 GTGGGAGAAAGCAGAGAGGTGGG - Intronic
1078692342 11:13594869-13594891 TTGGCAGGAAGCCATAAGGTAGG - Intergenic
1079173689 11:18119934-18119956 CTGGCTAGAAGCAGAGAGGTAGG - Intronic
1079385660 11:19977060-19977082 TTTGCATCAAGCAGAAAGGTAGG + Intronic
1079487500 11:20950752-20950774 CAGCAAGGAAGCAGAGAGGTGGG + Intronic
1080042067 11:27769466-27769488 ATGGCAGGGTGCAGAAAGGGTGG + Intergenic
1080124773 11:28720118-28720140 CTAGCAGAAAGCGGGAAGGTAGG - Intergenic
1080833558 11:35918915-35918937 CTGGCAGAAAGAAGAAGGGATGG + Intergenic
1081018968 11:37919510-37919532 CAGGCAGGAAACAGGAGGGTAGG - Intergenic
1081202904 11:40239683-40239705 CTGGCTGATAGCAGCAAGGTAGG - Intronic
1081669115 11:44933483-44933505 CTGGCAGGAGGGAGAAGGTTGGG + Exonic
1081807112 11:45896739-45896761 CAGGCAGGACGCAGAAAGACAGG + Intronic
1081965341 11:47165802-47165824 CTGGCACGGAGCTGAAAGGAAGG + Intronic
1082077005 11:47981740-47981762 ATGCCAGGAAGGGGAAAGGTCGG - Intronic
1083019026 11:59487386-59487408 CTGACAGAAACAAGAAAGGTGGG + Intergenic
1083193424 11:61068726-61068748 AGGGCAGGAAGCAGGAAGGCAGG - Intergenic
1083344865 11:61982293-61982315 ATGGGAGGAAGCAGGCAGGTGGG + Intergenic
1083751487 11:64763324-64763346 ACGGCAGGGAGCAGAAAGGGAGG + Intergenic
1084126127 11:67100189-67100211 CTTGCAGGAAGCCCAAAGGCAGG + Intergenic
1084187743 11:67483801-67483823 CTGGCAAAAAGGAGAAAAGTGGG - Intronic
1084196383 11:67525255-67525277 CTGGCAGAACGCAGGGAGGTGGG - Intergenic
1084349581 11:68586403-68586425 CTGGCTGAAAGCAGAAGGGTAGG - Intronic
1084562711 11:69913487-69913509 CTGGCAGGAAGCAAGAGGTTGGG - Intergenic
1086171381 11:83840318-83840340 CTGGCAGGTAGCAGAAACTCAGG + Intronic
1087461732 11:98455403-98455425 CTGACAGCAAGGAGAAAGGGAGG - Intergenic
1087686679 11:101273153-101273175 CTGGCAGCAAGCAGAAGAGGTGG - Intergenic
1088093269 11:106067859-106067881 CTTGTAGGAAGCATAAAGTTGGG - Intronic
1089151440 11:116367377-116367399 CAGGCAGGAAGCAGAAGGGCCGG - Intergenic
1090201704 11:124862306-124862328 GTAGCAGGAAGCAGGGAGGTTGG - Intergenic
1090274509 11:125410101-125410123 CAGGCAGGAAGGGGAAAGGACGG + Intronic
1090437172 11:126696535-126696557 CTGCCTGGAGGCTGAAAGGTGGG - Intronic
1090438057 11:126703174-126703196 ATGGCAGGAAGCAGCACGGCTGG - Intronic
1091233667 11:134004593-134004615 CTGGCAGGAAGAAAAAATGTGGG - Intergenic
1091996796 12:5000272-5000294 CTACCAGGATGCATAAAGGTTGG - Intergenic
1092646522 12:10579948-10579970 CTTGCAGGAAGCATAAAGTTAGG - Intergenic
1092663017 12:10759477-10759499 CTGGGAGGGAACAGAAAGGGAGG + Intergenic
1092836434 12:12493384-12493406 CTGGATGGAAGCAGGAAGGCCGG - Intronic
1093182611 12:15984019-15984041 CTGGCAAGCAGCATAAAGGGGGG - Intronic
1093905786 12:24690627-24690649 CTGGAGGGAAGCAGAGAGGATGG - Intergenic
1094749769 12:33392446-33392468 CTGGGAGGAAGAGGAAAGGCAGG - Intronic
1095249133 12:39958259-39958281 CAGACAGGCAGTAGAAAGGTGGG - Intronic
1095562197 12:43578822-43578844 CTGGGAGGAAGAAGAGAAGTTGG + Intergenic
1095659749 12:44717802-44717824 CTGGCAGGAAACTGGAAGGCAGG - Intronic
1099186837 12:79524203-79524225 CTGGAAGGAAGGAGAAAAGATGG + Intergenic
1100607691 12:96165329-96165351 CCTGCAGGAAGGAGGAAGGTGGG + Intergenic
1101654531 12:106708385-106708407 CTGGCAGGGAGGAGAGAGTTGGG + Intronic
1102146515 12:110658737-110658759 TTGGCAGGCTGCAGAAAGGCAGG - Intronic
1102961174 12:117094241-117094263 CAGGCAGGGAGAAGGAAGGTGGG + Intronic
1103067589 12:117913042-117913064 GGGGCAGGAAGCAGGAAGGTGGG + Intronic
1104071744 12:125351870-125351892 CTGTCATGAAGCAGCAAGGCTGG + Intronic
1104247125 12:127054601-127054623 CCTGCAGGAAGGAGGAAGGTAGG + Intergenic
1104270478 12:127278473-127278495 CAGGCAGGACCCAGAGAGGTTGG + Intergenic
1105201377 13:18182560-18182582 CTGGGAGGCAGCAGACAGGCTGG + Intergenic
1105912026 13:24878122-24878144 CAGGCAGGAATCACAAAGGAGGG - Intronic
1106101860 13:26700462-26700484 CAGGCAGGAAGCAAAAGGGGCGG + Intergenic
1109234015 13:59793302-59793324 CTGGGAGGAATGAGAAAGGAGGG - Intronic
1109479190 13:62926693-62926715 GTGGGAGGAAGAGGAAAGGTGGG + Intergenic
1110713775 13:78678337-78678359 CAGGGAGGAAGCAGAAAGGAAGG - Intergenic
1110906749 13:80898983-80899005 CTGGAAGGAAGGAGAAATGGGGG + Intergenic
1111469924 13:88666892-88666914 CTATCAGGAAGCAGAAGTGTTGG - Intergenic
1112813904 13:103250727-103250749 CTGGCAGCAGGGAGAAAGGGAGG - Intergenic
1113301996 13:109032396-109032418 CTGGGAAGAAGCACAAAGGATGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114483722 14:23050703-23050725 CTGGCAGTGAGAAGCAAGGTAGG - Intronic
1115799202 14:36973228-36973250 ATGGCAGGAAGCAGAGAAGCTGG + Intronic
1117010132 14:51462550-51462572 TTACCAGGAACCAGAAAGGTGGG - Intergenic
1117128429 14:52657765-52657787 ATGGTAGTAATCAGAAAGGTGGG - Intronic
1117875421 14:60246965-60246987 AAGGAAGGAAGCAGAAAGATAGG + Intronic
1118210940 14:63765121-63765143 ATGGAAGGAAGAGGAAAGGTGGG - Intergenic
1119473879 14:74916013-74916035 GTGGCAGGGAGCAGTGAGGTGGG - Intronic
1119693093 14:76692056-76692078 CCGGCAGGAAGGAGGGAGGTCGG + Intergenic
1119959602 14:78839683-78839705 GTAGCAGGAGGCAGAAAGGTTGG - Intronic
1120649208 14:87111091-87111113 ATGAAAGGAAGCAGAAAGGGAGG - Intergenic
1120983294 14:90310317-90310339 CAGCCAGGCAGCAGCAAGGTTGG - Intronic
1121838653 14:97114868-97114890 CCAGCAGCCAGCAGAAAGGTGGG + Intergenic
1122651825 14:103230607-103230629 CAGGAAGGAAGGAGAGAGGTGGG + Intergenic
1122909586 14:104820864-104820886 CTGGCAGGAGACTGAAAGGCAGG - Intergenic
1123974629 15:25541644-25541666 ATGGCAGGCAGCACAAAGTTGGG + Intergenic
1125047027 15:35253625-35253647 ATGGGAGAAAGCAGAAATGTGGG - Intronic
1125521290 15:40349123-40349145 TTGGCAGGAAGCTGAAAGAGAGG - Intergenic
1125568757 15:40698090-40698112 GCGGCAGGAAGGAGAGAGGTTGG - Intronic
1125727127 15:41873825-41873847 CAGGTAGGATGCAGAGAGGTGGG - Exonic
1126510584 15:49467801-49467823 CTGGCCCAAAGGAGAAAGGTGGG + Intronic
1128880484 15:71237708-71237730 TTGGCAGGAAACAGAAAGGCGGG + Intronic
1129220977 15:74131411-74131433 CTGGCAGGAACCGGGAAGGGAGG + Intronic
1129534438 15:76300580-76300602 TTGGTAGGAAGCAGAATTGTAGG - Intronic
1129605673 15:77023873-77023895 CTGACAGGAAGCAGAGGGATTGG + Intronic
1129737365 15:77973821-77973843 CAGCCAGGAAGCAGAAGGGCTGG + Intergenic
1129829455 15:78658945-78658967 CAGGAAGGCAGCAGAAAGGAGGG + Intronic
1129848707 15:78779804-78779826 CAGCCAGGAAGCAGAAGGGCTGG - Intronic
1130126327 15:81097046-81097068 CAGGGAGCAAGCAGAAAGCTGGG - Intronic
1130163429 15:81425739-81425761 CTGACAGGGAGCAGAAAGATAGG - Intergenic
1130738530 15:86574223-86574245 CTAACAGGAAACAGGAAGGTAGG - Intronic
1130746579 15:86660167-86660189 CAGGCAAGGAGCAGAAAGGAGGG + Intronic
1131227522 15:90637669-90637691 CTGGCAGGTGGCAGGATGGTGGG + Intronic
1131311823 15:91297244-91297266 CAGGCAGGAAGCAGAAGGAAGGG + Exonic
1132411571 15:101582227-101582249 CTATCAGGAAGCAGAGAGGTGGG - Intergenic
1133727710 16:8553027-8553049 CTGGCAGGAAGCAAGAACCTCGG - Intergenic
1134438133 16:14280611-14280633 CTGGCAGAATGCAGCAAGATGGG - Intergenic
1136041102 16:27579603-27579625 CAGCCAGGAAGCAGGAAGGCTGG - Intronic
1138760911 16:59543165-59543187 GTGGCAGAAACCAGAAAAGTGGG - Intergenic
1139444603 16:66989106-66989128 ATGGAAGGAAGGAAAAAGGTGGG - Intronic
1139520882 16:67482118-67482140 CAGGAAGGAAGCAGACAGCTGGG - Intergenic
1140317477 16:73913100-73913122 CAGGTAGGAGGCAGAAAGGTAGG - Intergenic
1140329542 16:74040591-74040613 CTGGTGGGAAGAAGAAAGGAGGG + Intergenic
1140485317 16:75288816-75288838 CTGGCAGGGACCAGGAAGGCCGG - Intergenic
1141555902 16:84836655-84836677 ATCCCAGGAAGCAGAAACGTTGG - Intronic
1142235628 16:88921312-88921334 CACGCAGGCAGCAGAAAGGATGG + Intronic
1142674282 17:1503974-1503996 TTCGCAGAAAGCAGAAAGGCGGG - Intronic
1143312025 17:6000025-6000047 CAGGCAAGAAGCAGTGAGGTTGG - Intronic
1143563602 17:7708977-7708999 GTGGCAGGAAGCTGAAGGGCTGG + Intronic
1143644665 17:8222617-8222639 AAGTCAGGAAGCAGAAAGGGAGG + Intergenic
1143953546 17:10652227-10652249 GGGGCAGGAAGAAGGAAGGTGGG - Intronic
1144261743 17:13528253-13528275 CTGGCAGGCAACAAAAAGGATGG + Intronic
1144777315 17:17791405-17791427 CAGGGAAGAGGCAGAAAGGTGGG - Intronic
1146637022 17:34514104-34514126 GAGGCAGGAAGCAAAAAGTTGGG - Intergenic
1146950086 17:36899787-36899809 CTGGGAGGATGCAGAGGGGTGGG + Intergenic
1147260062 17:39204727-39204749 CTTGCAAGAAGCAGAGAGGAAGG - Exonic
1147742881 17:42678715-42678737 CTGGCCGGAAAGAGAGAGGTTGG - Intergenic
1147930449 17:43977360-43977382 CTGGGAGGTGGCGGAAAGGTGGG - Intronic
1148128872 17:45250780-45250802 CTGGCAGGATGCAGAAAGGGAGG - Intergenic
1148142549 17:45338737-45338759 CTGGGAGGAAGCAGTGAGGTGGG + Intergenic
1149570171 17:57666730-57666752 CTGGCAGGTAGCAGGCAGGGAGG + Intronic
1149627470 17:58089969-58089991 CTGGCAGGAAGAACAAAAGAAGG - Exonic
1149684152 17:58525921-58525943 CTGGGAGGAAGCACAGAGATTGG + Intronic
1150004076 17:61458930-61458952 CTGCCAGGGAGCAGAGAGGAAGG - Intronic
1151173469 17:72267897-72267919 CTCGTAGGAGGCAGAAAGGGTGG + Intergenic
1151304366 17:73253529-73253551 CTGGCAGCAATGGGAAAGGTAGG + Intronic
1151354535 17:73550596-73550618 GTGGCAGGAAGCTGCAGGGTAGG - Intronic
1151378269 17:73706740-73706762 CAGGGAGGAAGCAGAAAGGAGGG + Intergenic
1151417720 17:73977395-73977417 CTGGCAGGAGGCAGGCAGGTGGG - Intergenic
1151844558 17:76643317-76643339 CTTGCAGGGAACAGAAAGGGTGG - Intronic
1151957914 17:77389664-77389686 GTGGAAGGCAGCAGAAGGGTGGG - Intronic
1153526057 18:5995760-5995782 CTGGCAGGAAGGAGTGAGGCTGG + Intronic
1154637484 18:16876581-16876603 CTACCAGGAAGCACAAAGGTGGG - Intergenic
1155735930 18:29222224-29222246 ATGGCAGAAGGCAGAAATGTAGG - Intergenic
1157086279 18:44583256-44583278 CTAGCTTGAAGCAGAAAAGTGGG - Intergenic
1157113507 18:44842719-44842741 GTGGGAGGAAGCTGAAAGGAGGG + Intronic
1157535745 18:48456108-48456130 CTGGAGGGAAGAAGAAAGGAAGG + Intergenic
1157593494 18:48850045-48850067 CAGACAGGGAGCAGAATGGTGGG - Intronic
1157791108 18:50531992-50532014 CAGGCAGGACCCTGAAAGGTGGG - Intergenic
1159618346 18:70608405-70608427 CTGGCTGGAGTCAGAAAGATGGG + Intergenic
1159853038 18:73549509-73549531 CTGGGAGGAATCAGAATGATTGG - Intergenic
1160423208 18:78763095-78763117 CTGGAACAAAGCAGCAAGGTGGG + Intergenic
1160551618 18:79697150-79697172 CTGGCAGGTGCCAGAAAGATGGG - Intronic
1162175119 19:8824611-8824633 ATGGGAGGAGGCAGAAGGGTGGG - Intronic
1162288700 19:9761770-9761792 CTGGTAGTAAGCAAAAAGATGGG + Intronic
1162730433 19:12715325-12715347 CTGGCGGGGAGCAGACACGTGGG + Intronic
1162753349 19:12841972-12841994 CTGGGAGGAAGAAGGAAGGGAGG + Intronic
1163013327 19:14439123-14439145 CTGAGAGGAAGCAGGAAGTTGGG + Intronic
1163289774 19:16371663-16371685 CTGGCAGGAAGTGGCAAGGGTGG + Intronic
1163760196 19:19132325-19132347 CTGGCAGGGAGCAGAGAGGAAGG + Intronic
1164578461 19:29419560-29419582 CTGAGTGGAAGCAGAAGGGTGGG - Intergenic
1164767213 19:30781252-30781274 CAGGCAGGAGGCAGAAATGCAGG + Intergenic
1164856569 19:31529326-31529348 AGGGCAGGAAGCAGGAATGTGGG - Intergenic
1165903795 19:39181313-39181335 CTGGCAGGAGGCAGCCACGTGGG - Intronic
1166671819 19:44714817-44714839 CAGGCAAGAAGCAGAAAGAAGGG + Intergenic
1166800871 19:45456166-45456188 GGGGCAGGAAGGAGAAAGTTTGG + Intronic
1167294287 19:48640232-48640254 CAGGCAGGAAGGAGACATGTCGG + Exonic
1167374593 19:49104041-49104063 ATGGCAGGGAGCAGAGAGGCGGG - Intronic
1167502675 19:49856609-49856631 CTAGGAGGCAGCAGAACGGTGGG + Intronic
1167706493 19:51084182-51084204 CCAGCAGGGAGCAGGAAGGTTGG + Exonic
926854791 2:17243071-17243093 TTGGCAGGAAGCATAAAAATGGG + Intergenic
927088905 2:19695582-19695604 TTGGCAGGAGGAAGAAAGATTGG + Intergenic
927421981 2:22943337-22943359 CTGGCAGAAAGGAGGAAGGAGGG - Intergenic
927571408 2:24164172-24164194 CAGGAAGGAACCAGAAAGGAAGG - Intronic
927673980 2:25091217-25091239 GTGGCAGGAAACAGACAGGCTGG - Intronic
927822119 2:26276505-26276527 CTGGCAGTGAGCAGAAAGATAGG + Intronic
927845143 2:26467502-26467524 CTGGCCAGAAGCAGAAAAGGAGG + Intronic
928428566 2:31199465-31199487 CTCACAGGAATCAGGAAGGTGGG - Exonic
932187302 2:69709368-69709390 TTGGCACTAAGAAGAAAGGTGGG - Intronic
932199092 2:69810003-69810025 GTGGCAGGAAGCACAGAGGGAGG + Intronic
932607470 2:73174979-73175001 CAGATAGGAAGCTGAAAGGTGGG + Intergenic
932940692 2:76161264-76161286 CTGGCTGGAAGCTGGAACGTGGG - Intergenic
933172135 2:79136258-79136280 TTGGCAGGACACAGAGAGGTAGG - Intergenic
934518568 2:95005050-95005072 CTGGCAGGCTGTAGGAAGGTGGG - Intergenic
935278474 2:101496559-101496581 CAGGCAGGCAGAAGAAAGGGAGG - Intergenic
935660958 2:105466443-105466465 GTGGCTGGAAGCAGAAATGGGGG + Intergenic
936111827 2:109671135-109671157 CTGGTAGGAAGCAGCAGTGTGGG - Intergenic
937985872 2:127637885-127637907 GAGGAAGGAAGCAGAAAGGGAGG - Intergenic
938464848 2:131518785-131518807 CTGGCAGGAAGGAGGGAGGCTGG + Intergenic
938594708 2:132776393-132776415 CTGGCAAGGAGCTGACAGGTAGG - Intronic
938733102 2:134161506-134161528 CTGGCAGGAGGCAGAAGCCTGGG + Intronic
940254381 2:151713614-151713636 CTGGAAGGGAGCAGAGAGGCAGG + Intronic
940888427 2:159011823-159011845 CTGCCAGGAAGCAGGAGGGCAGG - Intronic
942324801 2:174767000-174767022 TTGGCAGTAAGCAGAAAGCCAGG - Intergenic
942461118 2:176169530-176169552 CTGCCAAGAAGCCCAAAGGTGGG + Exonic
943732856 2:191321646-191321668 CTGGGAGGAAGCAGACAGCAGGG - Intronic
944683480 2:202097550-202097572 CTGGCAGGAAGATGAAACGCAGG + Exonic
945054954 2:205860399-205860421 ATGGCAAGAGGCAGAAAGTTGGG + Intergenic
945742912 2:213685301-213685323 CTTGTAAGAAGGAGAAAGGTGGG + Intronic
946142493 2:217703620-217703642 CTGGGAGGGAGGAGAAGGGTTGG + Intronic
946186343 2:217982844-217982866 CAGGCACCAAGCAGCAAGGTAGG - Intronic
947341955 2:229149910-229149932 CTGGGAGGGAACAGAAAGGAAGG + Intronic
948607867 2:239147292-239147314 AGGGCAGGAAGCAGGAAGGCTGG - Intronic
1169014738 20:2282416-2282438 CAGGAAGGTAGCACAAAGGTGGG + Intergenic
1169250847 20:4060285-4060307 CTGGCAGGCAGCAGGAGGGGCGG - Intergenic
1169583736 20:7057366-7057388 CTGGTAGGAAATAGAAGGGTAGG + Intergenic
1169648592 20:7842107-7842129 CTGGCAGGAAGCGGATAGTCGGG + Intergenic
1170040778 20:12036920-12036942 CAAGCAGGAAGCCGAAAGCTGGG + Intergenic
1170459469 20:16563959-16563981 CTGGCTGGAAAGAGAAAGGAGGG - Intronic
1170757239 20:19214825-19214847 AAGGTAGGAAGGAGAAAGGTAGG - Intronic
1171294847 20:24008497-24008519 CTGGCAGGATGCAGAAGGCCAGG - Intergenic
1171511813 20:25692001-25692023 CTGGCAGGCAGAAGGAAGGAAGG + Intronic
1172128341 20:32638804-32638826 CTGGAGAGAAGCAGAAAGGGGGG + Intergenic
1172572307 20:35980269-35980291 CTGGCAGGATGCAGTGAGATGGG + Intronic
1172639043 20:36430067-36430089 CTGCCATGGAGCAGAGAGGTTGG - Intronic
1172785970 20:37469244-37469266 CAGGCAGGAAGGAGAGAGGCAGG - Intergenic
1172992398 20:39046294-39046316 CTGGTAGGAGGCAGAAATCTGGG + Intergenic
1173183637 20:40822559-40822581 TTTGCAGGAAGCAGGAAGCTGGG - Intergenic
1174367406 20:50064852-50064874 CTGGATGGAAGGAGAAAGGGAGG - Intergenic
1174393364 20:50231723-50231745 CTGGTGGGGAGCAGACAGGTGGG + Intergenic
1174395900 20:50246787-50246809 CTGCCAAGCAGCAGACAGGTTGG - Intergenic
1174562957 20:51444461-51444483 CAGCCAGGAAGCAGTAGGGTTGG + Intronic
1175763135 20:61574492-61574514 AAGGCAGGAAGGAGAAAGGGGGG - Intronic
1175945054 20:62554819-62554841 GTGGCTGGATGCAGAAAGGAGGG + Intronic
1176716573 21:10355428-10355450 CTGGGAGGCAGCAGACAGGCTGG - Intergenic
1178451757 21:32708132-32708154 GTGGCAGGGAGTAGTAAGGTGGG + Intronic
1178930993 21:36819061-36819083 CTGGCAGGAAGCAGCAGCTTAGG + Intronic
1179299145 21:40090756-40090778 CTGGCAGGAGGCAGAAATTCAGG - Intronic
1179978058 21:44881924-44881946 CTGGGAGGATGCAGAGAGGCTGG - Intergenic
1180601766 22:17024508-17024530 CTGGGAGGGAGCAGACAGGCTGG + Intergenic
1181438385 22:22923266-22923288 CAGGCAGGAGGCAGGGAGGTGGG - Intergenic
1181588139 22:23865524-23865546 CTGCCCTGAGGCAGAAAGGTTGG + Intronic
1181617158 22:24062793-24062815 GTGGCAGGCATCAGAGAGGTTGG - Intronic
1181622238 22:24099027-24099049 CTGGCAGGAAGCAGAGCCCTGGG - Intronic
1181624620 22:24114780-24114802 CTGGCAGGGAGCAGAGAGCTAGG - Intronic
1181646800 22:24235781-24235803 TAGGCTGGAAGCAGACAGGTTGG - Intronic
1181733371 22:24863601-24863623 ATGGCAGGAGTCAGAAATGTGGG + Intronic
1181932968 22:26417584-26417606 CCGGCAGGAAATAAAAAGGTGGG + Intergenic
1182468138 22:30530878-30530900 GGGGCTGGAAGCAGAAGGGTAGG + Intronic
1182667681 22:31971366-31971388 CTGGCAGGAACCGCAATGGTTGG - Intergenic
1182827767 22:33280600-33280622 CTGGCAGCTTGCAGAAAGGCTGG + Intronic
1182836010 22:33341917-33341939 GCGGCAGGAAGGAGAAAGGAGGG - Intronic
1182991572 22:34772573-34772595 CAGGAAGTAAGCAGAGAGGTAGG - Intergenic
1184351268 22:43945679-43945701 CTGGCAGCAGGCAGCAAGGGGGG + Intronic
1184783498 22:46660674-46660696 CGGGCAGGAAGCAGACAGTGAGG - Intronic
1185128377 22:49024223-49024245 CTCGCAGGAAGCAGAAAGCGTGG + Intergenic
949158186 3:851640-851662 CCTGCTGGCAGCAGAAAGGTAGG + Intergenic
949643244 3:6063912-6063934 CAGGCAGGAAGAACAAAGGTGGG + Intergenic
949709676 3:6860191-6860213 ATGGCAGGAAGAAGAAAGAGGGG - Intronic
950092451 3:10305442-10305464 CTGGCAGGAGGGAGAAAGAAAGG + Intronic
950478880 3:13232493-13232515 GTGGCAGGGAGAAGAAAGGCGGG + Intergenic
950571015 3:13800009-13800031 CGGGCAGGAATTAGAAAGCTGGG + Intergenic
951243909 3:20317854-20317876 TTGGCAGAAAGCAGAAAGATGGG + Intergenic
951563883 3:23993620-23993642 ATGCCAGGAAGCAGAAATGAGGG + Intergenic
951657190 3:25022792-25022814 GTGGCAAGAAGCAGCATGGTGGG + Intergenic
952211392 3:31232184-31232206 CTGGCAGGTAGCAGAGAGCTGGG - Intergenic
952211655 3:31234132-31234154 TGGGCAGGAAGCACAAAGCTGGG + Intergenic
953475968 3:43206111-43206133 CAGGCAGGAGACAGAAAGGGAGG + Intergenic
953685072 3:45071254-45071276 CAGGCAGGAAGAAGAGAGGTGGG + Intergenic
953685303 3:45073479-45073501 CAGGCAGGAAGAAGAGAGGTGGG - Intergenic
954280878 3:49576859-49576881 CTGGCATCAAGAAGAAAGGCAGG - Intronic
954288294 3:49635158-49635180 CTGGCATGAAACAGGCAGGTTGG + Intronic
954624513 3:52015301-52015323 CTGGCTGGAAGCAGCTAGATGGG - Intergenic
955160270 3:56458672-56458694 CTGACAGGAAGCAGGAGGTTGGG - Intronic
955465703 3:59235117-59235139 CTCACAGGAAATAGAAAGGTTGG - Intergenic
955954652 3:64276389-64276411 TAGGAAGGAAGCAGGAAGGTGGG + Intronic
956036722 3:65101280-65101302 ATTGCAGGAGGCAGAAAAGTTGG - Intergenic
956047361 3:65209894-65209916 CTGGGTGCAAGCAGAAAGATGGG + Intergenic
956515148 3:70038378-70038400 CTGGCAGAAAGTGGAAAGGGAGG - Intergenic
956682093 3:71790420-71790442 CTGGCAGGAAGACAAGAGGTAGG - Intergenic
958472500 3:94538304-94538326 ATGGCAGAAGGCAGAAAGGCAGG - Intergenic
960824159 3:121765892-121765914 CTTGAAGGCAGCAGAAAGATGGG + Intergenic
961186415 3:124918870-124918892 CTGGCAGCAAACAGACAGGCTGG - Intronic
961322290 3:126084158-126084180 CAGGCAGGAAGCGGGAAGGCCGG + Exonic
962716525 3:138130929-138130951 CTGACAGGAAGGAAAAAGCTGGG + Exonic
962854161 3:139329276-139329298 GTGGCAGGAAGGAGAGAGGGTGG + Intronic
962876150 3:139537624-139537646 CTGGCAGAAAGCAGGACTGTGGG + Intronic
963201116 3:142586824-142586846 GAGGCAGGAAGCAGAGTGGTTGG + Intergenic
964389663 3:156184264-156184286 CTGGCAGAAAACAGAATGGAAGG - Intronic
966629633 3:182058186-182058208 CTGACAGGAGGCAGGAGGGTTGG + Intergenic
968423072 4:501424-501446 CTGGAAGGATGAATAAAGGTGGG + Intronic
968528524 4:1077519-1077541 CTGGCAGGCAGCAGGCATGTCGG - Intronic
968653804 4:1770222-1770244 CTGGCAGGAAGGAGGAGGGCTGG + Intergenic
968657889 4:1786506-1786528 GTGGCAGGAAGCATAAGGGCTGG + Intergenic
969664873 4:8551571-8551593 CAGGCAGAAAGCAGAAAGAAAGG - Intergenic
969673713 4:8603427-8603449 CAGGAAGGAAACAGAAAGGGGGG - Intronic
969719438 4:8885182-8885204 CTGGCAGGAGGCAGGCAGGAAGG + Intergenic
969838746 4:9864930-9864952 CTGGAAGCCAGGAGAAAGGTTGG + Intronic
969926956 4:10594105-10594127 CTGGTGGGAAGCAGAAGAGTGGG - Intronic
970020059 4:11557856-11557878 CTGCAAGGCAGCAGAAAGGCTGG + Intergenic
970940232 4:21623933-21623955 CTGGGATGGAGCAGAAAGGAAGG - Intronic
971401368 4:26278869-26278891 CTGGCAGGCATCAGGAAGTTTGG + Intronic
972316821 4:37934482-37934504 TTGGAAGGAGGGAGAAAGGTGGG + Intronic
972455147 4:39246780-39246802 CTGCAAGGCAGCAGAAAGGCTGG + Intronic
974388590 4:61234520-61234542 CTAGGAGGAAGCAGAAAGAATGG + Intronic
975171341 4:71234961-71234983 AAGGAAGGAAGCAGAAAGGAAGG + Intronic
975917212 4:79340171-79340193 ATGGCAGGATGCAGTATGGTGGG - Intergenic
978463730 4:108985233-108985255 CTGGGAGGAAGCACAGAAGTGGG - Intronic
979415442 4:120432599-120432621 TTGGCAGGGAGCTGAAAGGCAGG - Intergenic
980349943 4:131671042-131671064 CTATCAGGAAGCACAAAGGTGGG - Intergenic
980698615 4:136394375-136394397 CTATCAGAAAGCAGAAAGGAAGG - Intergenic
980867653 4:138572442-138572464 CTGGCTGGAAGCATTAAGGTAGG - Intergenic
981438358 4:144752876-144752898 CTGGTGGGAAGAAGAAAGGGAGG + Intergenic
981585967 4:146302701-146302723 CTGGCAGAGGTCAGAAAGGTAGG + Intronic
981887596 4:149695727-149695749 CTGGCAGAAAACAGAAAGAATGG + Intergenic
982214016 4:153064822-153064844 CTGGCAGGTAGCAGCAAGGCGGG - Intergenic
983413749 4:167429034-167429056 ATGGCAGAAGGCAGGAAGGTAGG + Intergenic
983627672 4:169818761-169818783 CGGGAAGGAAGAAGTAAGGTGGG - Intergenic
983804565 4:171978399-171978421 CAGGCAGGAATCAGAAAAGGAGG + Intronic
984284137 4:177707967-177707989 CTGGCAGGAGATGGAAAGGTGGG + Intergenic
985222287 4:187720412-187720434 CTGGAAGGAGGCAAAGAGGTTGG + Intergenic
985793757 5:1947064-1947086 CGGGGAGGAAGAAGGAAGGTGGG - Intergenic
987236760 5:15950455-15950477 CTGGCAGGAGGCCGCAAGGCTGG + Intergenic
988237553 5:28564832-28564854 ATGGCAGAAGGCAGACAGGTAGG - Intergenic
988842667 5:35098028-35098050 CTGGGAGGAAGCAAATAGTTGGG - Intronic
990882518 5:60555884-60555906 CTGCAAGGCAGCAGCAAGGTTGG + Intergenic
990964473 5:61430175-61430197 TAAGCAGGAAGAAGAAAGGTGGG + Intronic
991026748 5:62037920-62037942 CAGCCAGGAAGCACAAAGGGAGG - Intergenic
992299511 5:75363885-75363907 TTGGCAGGGAGCATAAAAGTAGG + Intergenic
992609395 5:78494259-78494281 CTGGGAGGAAGAAGAAATGGGGG + Intronic
993088046 5:83388304-83388326 CAGGAAGGAAGCAGCAAGGGAGG + Intergenic
993484086 5:88460981-88461003 CTGGCTGCAAATAGAAAGGTGGG - Intergenic
994086278 5:95762747-95762769 CTGTTAGGAAGCAGGGAGGTTGG + Intronic
994356453 5:98798927-98798949 CTAACAGGAAGCAGTAAGGTGGG + Intergenic
995014918 5:107299182-107299204 GTGAAAGGAAGAAGAAAGGTAGG + Intergenic
995154789 5:108898115-108898137 CTGGGAGACAGCAGGAAGGTAGG + Intronic
996905504 5:128595324-128595346 TTGGCAAGGAGCAGGAAGGTAGG + Intronic
997036183 5:130194721-130194743 CTGGGAAGAGGCACAAAGGTGGG - Intergenic
997690793 5:135826190-135826212 CTGGCAGGGAGCAGCCTGGTGGG - Intergenic
998025623 5:138813505-138813527 CTGACAGGTAGTAGAAAGTTGGG + Intronic
1000293583 5:159893653-159893675 CTTGCACGCAGCAGAAAGCTAGG - Intergenic
1000546703 5:162611336-162611358 ATGGCAGGAACAAGAAAGATGGG - Intergenic
1001114574 5:168928813-168928835 CTGGAAGGAAGCTGAGAAGTGGG + Intronic
1001485857 5:172119187-172119209 CAGGCAGGGAGCGGGAAGGTGGG + Intronic
1001668048 5:173449646-173449668 CTGGTAGGAGACAGAAAAGTGGG + Intergenic
1002041966 5:176521151-176521173 CTGGAAGGGAGGAGAGAGGTGGG + Intergenic
1002540751 5:179904880-179904902 CTGGCCGGAGGCAGACAGGATGG + Intronic
1002778689 6:349883-349905 CTGGCAAGGAGCAGAGAGGAGGG - Exonic
1003123613 6:3337925-3337947 CTGCCTCTAAGCAGAAAGGTGGG - Intronic
1004090353 6:12494445-12494467 CTGGCAGGGAAGGGAAAGGTAGG - Intergenic
1004987850 6:21102856-21102878 CTGGCAGGAAGCAGAAAGGTAGG - Intronic
1006445671 6:34078523-34078545 AAGGCAGGAAGCAGAGAGGACGG - Intronic
1007265480 6:40592543-40592565 CTGGCAGGAGGTAGAAAGCCAGG - Intergenic
1009233279 6:61091957-61091979 CTGGCAAGAAACAAAAGGGTGGG + Intergenic
1009328212 6:62380796-62380818 TTAGCAGGAAGCTGAAAGTTTGG + Intergenic
1010220221 6:73442375-73442397 CTGGAAGGAAGCAGAAAGATGGG - Intronic
1010260488 6:73810014-73810036 CTGCCAGGAGTCAGAAAGTTTGG - Exonic
1010497654 6:76554736-76554758 CTGCTATGAAGCAGAAATGTGGG - Intergenic
1010503454 6:76628855-76628877 CTGGAAGGCAGCAGCAAGGCTGG - Intergenic
1011376069 6:86688068-86688090 CTGACATCAATCAGAAAGGTCGG - Intergenic
1011784537 6:90829194-90829216 CTGGCTGGAAACAGAAAGGTTGG - Intergenic
1013077232 6:106782237-106782259 CAGGCAGGAAGCAGGAACGTAGG + Intergenic
1013304747 6:108837988-108838010 CAGGAAGGAAGCAGAGGGGTGGG - Intergenic
1013398311 6:109766428-109766450 CTGGCAGGCTGCAGAAAGTTAGG + Intronic
1013616633 6:111849566-111849588 CAGGCTGGAGGGAGAAAGGTGGG + Intronic
1013900370 6:115148501-115148523 GTGGCAGGAGGGAGAAAGGGAGG + Intergenic
1013988829 6:116229511-116229533 CTGGCAGGAATCAGACTGGAGGG - Intronic
1013994748 6:116295184-116295206 CTTGAAGGCAGAAGAAAGGTGGG + Intronic
1014167798 6:118245623-118245645 GTTGCAGGAATCACAAAGGTTGG - Intronic
1015221683 6:130811392-130811414 ATGGCAGGAAGCACAAATGAGGG + Intergenic
1015654229 6:135498379-135498401 GTGGCAGAAATCAGAAAAGTGGG - Intergenic
1015821360 6:137264441-137264463 ATGGCTGAAAGCAGAAAGGCAGG - Intergenic
1016658378 6:146545441-146545463 CTGGCTGGTAGCAGAGTGGTTGG + Intronic
1016926214 6:149351023-149351045 CTTGCAGGAGGAAGAAAGGAGGG - Intronic
1018063564 6:160109330-160109352 CTGGAAGGAAGCAGGAAGTCAGG + Intronic
1018370782 6:163165756-163165778 CTGGCAGAAAGGGGAAAGCTGGG + Intronic
1018665151 6:166128303-166128325 CTGCCAGGCTGCAGAAAGGCAGG - Intergenic
1019449373 7:1089054-1089076 GTGGCAGGAAGTTTAAAGGTGGG - Intronic
1019648516 7:2143739-2143761 CTGCCTGGAGGCAGCAAGGTGGG + Intronic
1019655166 7:2189605-2189627 GAGGCAGGAAGCAGAATGGTGGG + Intronic
1019900952 7:4020253-4020275 GTGGCAGGCAGCAGGAAGGGTGG + Intronic
1020540527 7:9457604-9457626 CTTGAAGAAAGCAGAAAGTTGGG + Intergenic
1021692963 7:23248020-23248042 CGGGCAGGAAGGACAGAGGTCGG - Intronic
1022318581 7:29266784-29266806 ATGGCAGCAAGGAGAAAGGCAGG - Intronic
1022334777 7:29411964-29411986 GTGGCAGGGAGCTGACAGGTGGG - Intronic
1022520790 7:31005656-31005678 CTGGGAGGAAGGAGACAGGAAGG + Intergenic
1024095942 7:45982977-45982999 CTGGCAGGCAGCTGAGAGGAAGG + Intergenic
1024154564 7:46607188-46607210 CTAGCAGAGAGCAGAAAGATGGG - Intergenic
1024565957 7:50681228-50681250 CTGGCAGGGTGCAGAAGGCTGGG + Intronic
1024954111 7:54897961-54897983 AGGGCTGGAAGCAGCAAGGTTGG + Intergenic
1027757288 7:82230153-82230175 CTGGAAGGGAGCACAAAGGAGGG - Intronic
1028718889 7:94006355-94006377 CAGGCAGGAAGCAGACAGATAGG - Intergenic
1028909991 7:96197048-96197070 CTGACAGGAAGCAGTAAAGCTGG + Intronic
1029176390 7:98667753-98667775 TGGGCAGGAGGCAGAAAGATGGG + Intergenic
1030265195 7:107614017-107614039 CTGGCTGGCAGCAGAAGGGAGGG - Intronic
1031910464 7:127511778-127511800 ATGGCAGGAGGGAGAAAAGTTGG + Intergenic
1032081479 7:128860618-128860640 CTGGCTGGAAGCAGGCAGGCTGG - Intergenic
1032346855 7:131124552-131124574 CTGAAAGGAAGCACAATGGTGGG - Intronic
1034433704 7:151053286-151053308 CTGGCAGGAAGAGGAAGGGAGGG - Intergenic
1034487484 7:151374966-151374988 CGGGCAGGAAGCAGAGTGGTAGG + Intronic
1034644799 7:152635947-152635969 GAGACAGGAAGCAGAAGGGTGGG - Intergenic
1035014304 7:155751471-155751493 CTGGCTGGACCCTGAAAGGTGGG - Intronic
1035531047 8:351081-351103 TAGGCAGGCAGCAGATAGGTAGG + Intergenic
1036213915 8:6863594-6863616 CTGGCAGGGAGTGGAAAGGCTGG + Intergenic
1036567610 8:9951043-9951065 CTGGGAGGTCTCAGAAAGGTGGG - Intergenic
1036759356 8:11496685-11496707 CAGGAAGGAAGCAGAAAGCCAGG + Intronic
1036923360 8:12879634-12879656 CTGAGATGAAACAGAAAGGTAGG + Intergenic
1037994373 8:23341864-23341886 CTGGCAGGGATCAGGGAGGTAGG + Intronic
1038281277 8:26167448-26167470 GAGCCCGGAAGCAGAAAGGTGGG + Intergenic
1038403434 8:27304202-27304224 ATAGCTGGAAGCAGGAAGGTAGG + Intronic
1038470964 8:27820164-27820186 CTGGAATGAAGCAGAAAAGAGGG - Intronic
1039210164 8:35204620-35204642 TTGGCAAGAGGCAGACAGGTGGG - Intergenic
1039531504 8:38267392-38267414 CTGGAAGAAAGCAGCATGGTTGG + Intronic
1041409461 8:57537090-57537112 CAGGGAGGAAGCAGAAATGAGGG - Intergenic
1043245261 8:77991397-77991419 GTGGCAGGAAGCAGAAGTGAAGG + Intergenic
1044016428 8:87052702-87052724 CTTACAGGCAGCAGAAAAGTTGG - Intronic
1044852464 8:96442357-96442379 CCTGCAAGAAGCAGAAAGGAGGG + Intergenic
1046191191 8:110796180-110796202 CTGGGAGGAAGTGGAAAGGATGG - Intergenic
1046509612 8:115185276-115185298 ATGGCAGGAAGCAGAAGGAATGG + Intergenic
1046801853 8:118437378-118437400 CTGGCAAGAAGAAGAAAGCAGGG - Intronic
1048335616 8:133499955-133499977 CTGGCAGGAAACAGACAGCTAGG + Intronic
1048395398 8:134009763-134009785 CTGTCAGGAAGCAGAATCGTTGG - Intergenic
1048838494 8:138544167-138544189 CTGCCAGCAAGTGGAAAGGTAGG - Intergenic
1049488306 8:142877728-142877750 ATGGCATGAAGCACAAAGCTTGG - Intronic
1049493195 8:142915762-142915784 ATGGCATGAAGCACAAAGCTTGG - Intronic
1050330880 9:4544898-4544920 GTGGCAGGAAGGAGAAAGGCTGG + Intronic
1050977954 9:11965677-11965699 TTAGCAGGAAGGAGAAAGGAGGG + Intergenic
1053159014 9:35800686-35800708 CTGTAAGGAAGCAAAAAGCTGGG - Intronic
1053209953 9:36219230-36219252 GGGACAGGAAGCAAAAAGGTAGG - Intronic
1053280412 9:36816799-36816821 CTGGCATGAATCTGGAAGGTTGG - Intergenic
1053409242 9:37904875-37904897 GTTGAAGGAAACAGAAAGGTCGG + Intronic
1053782826 9:41629019-41629041 CTACCAGGAAGCACAAAGGTGGG + Intergenic
1054170777 9:61839159-61839181 CTACCAGGAAGCACAAAGGTGGG + Intergenic
1054666759 9:67741648-67741670 CTACCAGGAAGCACAAAGGTGGG - Intergenic
1055201595 9:73669668-73669690 ATAGAGGGAAGCAGAAAGGTAGG + Intergenic
1055310407 9:74973854-74973876 CTGGCAGGAAGAACAAAAGAAGG - Intergenic
1055397711 9:75891913-75891935 CTGGAAGGGAGGAGAAAGGAGGG + Intronic
1055604457 9:77953852-77953874 CTGGCAGCAGGCAGAAGGCTGGG - Intronic
1055960835 9:81818703-81818725 CTGGCAGGAGAAAGAAAGGGAGG - Intergenic
1056032129 9:82564006-82564028 CTGGCAGGAAGAAGAGAGTGAGG - Intergenic
1056065118 9:82925469-82925491 CTGACAGCCAGCAGAAAGCTGGG + Intergenic
1056132050 9:83596926-83596948 CTTCCTGGAAGGAGAAAGGTTGG - Intergenic
1056148315 9:83757685-83757707 AAGGCAAGAAGCAGAAAGATTGG + Intronic
1057075132 9:92134629-92134651 GTGGCAGGGACCAGAAAGGTGGG + Intergenic
1057600642 9:96454159-96454181 CTTGGAGGAAGCAGAAAGGTGGG + Intronic
1057917826 9:99071319-99071341 CTGGGAGGGAGCAGAGAGGCAGG - Intergenic
1058136822 9:101316668-101316690 TTGGCAGGAAACAGAAAAGTGGG + Intronic
1059130168 9:111739492-111739514 GTGTCAGGAAGCAGAACAGTGGG - Intronic
1059737980 9:117121444-117121466 CAGGAAGGAAGCAGAATGCTTGG + Intronic
1061008992 9:127944281-127944303 CTGGGAGGAAGTAGAAGGGAGGG + Intronic
1061291219 9:129651290-129651312 CTGGGAGGAACCAGTAAGCTTGG - Intergenic
1062169492 9:135127088-135127110 CTGGCAGGAGGAACAAAGCTCGG + Intergenic
1062183635 9:135204687-135204709 CTGGCAGCCAGCAGAGAAGTAGG - Intergenic
1062317051 9:135972559-135972581 CAGACAGAAAGTAGAAAGGTGGG - Intergenic
1062405819 9:136395755-136395777 TTACCAGGAAGAAGAAAGGTGGG - Exonic
1062445949 9:136594831-136594853 GAGACAGGAAGTAGAAAGGTGGG + Intergenic
1062714523 9:138000516-138000538 CAGGCAGGAGGCAGAAAGATAGG - Intronic
1186925622 X:14330333-14330355 CTTGCAGGAAGAAGCAAGGAAGG + Intergenic
1187792499 X:22966186-22966208 CTGGAAGGAAGCAGAAAGCAGGG - Intergenic
1192166906 X:68832173-68832195 CGGGCAGGAGGCAGAGAGGGAGG - Intronic
1194376774 X:93145224-93145246 CTGGCTCTAAGCAGAAAGGTAGG + Intergenic
1194915794 X:99707002-99707024 CTGGCAGGTAGCAGAAAAAATGG - Intergenic
1195229261 X:102829733-102829755 CTGGGAGGGAGGAAAAAGGTGGG - Intergenic
1195260212 X:103124481-103124503 CTGGGAGGGAGAAGAAAGGTGGG + Intergenic
1195266304 X:103183493-103183515 CTGGGAGGGAGGAAAAAGGTGGG - Intergenic
1195830019 X:109046580-109046602 CTGGTAGGAAGTCGAAAGATGGG + Intergenic
1195925333 X:110019015-110019037 CTGGCAAAAGGGAGAAAGGTAGG + Intronic
1195986787 X:110639063-110639085 CTGGCAGGAAGCTGATTGATTGG - Intergenic
1196789562 X:119451760-119451782 CTGGAAGGAAGCAGACATTTGGG - Intronic
1196971752 X:121117000-121117022 CTGGGAGGGAGGAGAAATGTAGG + Intergenic
1197965979 X:132062208-132062230 CTGACTGGAAGTAGAATGGTTGG - Intergenic
1198310278 X:135422713-135422735 CAGGCCCGGAGCAGAAAGGTAGG + Intergenic
1199573004 X:149287010-149287032 CTGCCAGGAAACAGAAAGCGGGG + Intergenic
1200066059 X:153504562-153504584 CTGGCATGGAGAAGACAGGTGGG + Intronic
1200088463 X:153623398-153623420 CTGGCAGGAAGCAGAGTGGTGGG - Intergenic
1200134728 X:153869380-153869402 GTGTCAGCAAGGAGAAAGGTCGG + Intronic
1200175955 X:154116481-154116503 GAGGCAGGAAGCAGAATGGCCGG - Intergenic
1200466752 Y:3528957-3528979 TTGGCAGGAAGCAGTGAAGTTGG + Intergenic
1201405431 Y:13645217-13645239 ATGGCAAGAAGCAGAAAGAATGG + Intergenic