ID: 1004989798

View in Genome Browser
Species Human (GRCh38)
Location 6:21124633-21124655
Sequence CCATTGCCACAAAGAGAACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004989798_1004989803 22 Left 1004989798 6:21124633-21124655 CCTCGTTCTCTTTGTGGCAATGG 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1004989803 6:21124678-21124700 GTCAAATCTAGATAAATTATAGG 0: 1
1: 0
2: 0
3: 22
4: 243
1004989798_1004989801 0 Left 1004989798 6:21124633-21124655 CCTCGTTCTCTTTGTGGCAATGG 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1004989801 6:21124656-21124678 CAATGGCCACAAAGAGAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004989798 Original CRISPR CCATTGCCACAAAGAGAACG AGG (reversed) Intronic
904262809 1:29299745-29299767 CACTTTCCACAAAGAGCACGAGG + Intronic
905127871 1:35728431-35728453 CCATTGCCCAAAAGAAAACTGGG + Intronic
907596703 1:55726937-55726959 CCACTACCACAAGGAGAATGAGG - Intergenic
910689852 1:89954746-89954768 CCATTCTCAAAAAGAGAAAGTGG - Intergenic
912188533 1:107310102-107310124 CCATTTCAAAAAAGAGAATGTGG + Intronic
912464704 1:109863773-109863795 CTATTGCCACAAATAGCACTTGG - Intergenic
912842828 1:113053707-113053729 AGATTGCCACATAGAGAAGGGGG + Intergenic
917506820 1:175634933-175634955 CCTTTGCCATTAAGAGAATGAGG - Intronic
919405306 1:197173787-197173809 CCATGGGCACATAGAGAAAGAGG + Intronic
1068462608 10:57347168-57347190 CCATTGCCACAAAAATACCTAGG - Intergenic
1068704900 10:60064360-60064382 CAATTGCCACAAAAAGAAAAGGG + Intronic
1071502150 10:86211813-86211835 CCAATGCTGCAAAGAGAAAGTGG + Intronic
1073767892 10:106703512-106703534 CCATTGCCATTAAGAGCATGTGG - Intronic
1080406279 11:31982344-31982366 CCATCACCACAAAAAGAACATGG - Intronic
1081157407 11:39711457-39711479 TCATTGTCACAAAGGGAACATGG - Intergenic
1084296339 11:68214952-68214974 CCCTTGCCACAGAGAGGAGGCGG + Intergenic
1084952804 11:72676002-72676024 CCATTTTCTCAAAGGGAACGAGG + Intergenic
1085282146 11:75338159-75338181 CCAGTGCCACCTAGAGAATGGGG + Intronic
1088885468 11:114002969-114002991 CCATTGCCACTCAGAGGAAGGGG - Intergenic
1090626607 11:128613969-128613991 CCATTGCTTCCAAGAGAATGAGG - Intergenic
1101586577 12:106090553-106090575 CCATAACTACAAAGAGTACGAGG + Intronic
1110183430 13:72644537-72644559 CAATTGCCACAAAGATAAACTGG + Intergenic
1111496320 13:89055354-89055376 CCTGTTCCACAAAGAGAACAAGG - Intergenic
1112964046 13:105165093-105165115 CCTCTGCCACAAAGGGAACAGGG + Intergenic
1113862879 13:113501492-113501514 CCACTGCCCCAAAGATACCGAGG + Intronic
1116189237 14:41641985-41642007 CCATTGTCAGAAATAGAACATGG - Intronic
1117830295 14:59743503-59743525 GCATTGCCAGAAAGAGTACAAGG + Intronic
1119636002 14:76273938-76273960 CCAGTACCACAAAGAGAGAGGGG - Intergenic
1120300995 14:82706524-82706546 TCCTTGCCATAAAGAGAACAAGG + Intergenic
1122397815 14:101446771-101446793 CCATTCCCACCAAGAGGAAGAGG + Intergenic
1124812116 15:32951609-32951631 TCATTGCCACCATGAGAACTGGG - Intronic
1125751974 15:42035455-42035477 CCATTCCCAGCAGGAGAACGAGG - Intronic
1130872673 15:87983632-87983654 ACTTTGCCACAAAGTGAACTTGG - Intronic
1132032871 15:98452622-98452644 CCATTTCTGCAATGAGAACGTGG + Intronic
1139355707 16:66366151-66366173 CCATTCCCACAAAGACATCATGG + Intergenic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1143703068 17:8675823-8675845 CCTTTGCCACAAAGAAAGCCAGG + Intergenic
1146583226 17:34058699-34058721 GCATTCCCACAAAGAAAACGGGG - Intronic
1148854745 17:50572578-50572600 CTATTACCAGACAGAGAACGAGG + Exonic
1151103930 17:71589797-71589819 CTATTGCCATGAAGAGAAGGTGG + Intergenic
1151913315 17:77099043-77099065 CCATTGCAATAAAAAGAACTTGG - Intronic
1153847068 18:9059752-9059774 CCATTGACACAAAAAGCACACGG - Intergenic
1154072035 18:11161506-11161528 CCATAGGCACAAAGATAAGGTGG + Intergenic
1158131967 18:54162022-54162044 CCATAGCCAAGAAGAGAACAGGG + Intronic
1158829685 18:61263746-61263768 AAATTGCCACAGAGAGAAGGAGG + Intergenic
1167281847 19:48573787-48573809 CCATTGCTACAGAGAGGACATGG - Intronic
925818330 2:7775121-7775143 CCACTGCCACAAAAAGTACAAGG + Intergenic
935197041 2:100822980-100823002 TCTTTGCTACAAATAGAACGAGG - Intronic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
937185831 2:120041270-120041292 ACATTGCAACACAGTGAACGTGG - Intronic
938582930 2:132663608-132663630 CCTTTGCCAAAAATAGAATGTGG + Intronic
939986893 2:148838109-148838131 CCATAGGAACAAAGAGAACTGGG - Intergenic
947472787 2:230413845-230413867 CCATTGCCCCACAGAAAAGGTGG + Intergenic
1169206239 20:3741859-3741881 CTATGGCCACAAAGAGCAAGAGG + Intronic
1169935335 20:10877587-10877609 CCTTTGCCTCAAAGAGAGGGAGG + Intergenic
1172789669 20:37494245-37494267 TCATGACCACAAAGAGATCGAGG - Intronic
1175333292 20:58179140-58179162 TCATTGCCACAAACAGGACAGGG + Intergenic
1179099146 21:38341531-38341553 CCCTTTCCCCAAAGAGAACAAGG - Intergenic
1182524244 22:30905825-30905847 CCACCGCCACAGGGAGAACGCGG + Exonic
1184074166 22:42165507-42165529 CCCTTGGCACAAAGAGACAGTGG + Intronic
951780076 3:26353037-26353059 CCATTGCCAGAGAGAAAACAAGG + Intergenic
952661789 3:35859666-35859688 TCAATGCCACAAATAGAAGGGGG + Intergenic
953370117 3:42380436-42380458 CCATTTTCACCAAGAGAACTTGG - Intergenic
961459968 3:127043954-127043976 CCATTGCGACAGAGGGAATGGGG + Intergenic
962474708 3:135745173-135745195 ACATTGACTCAAAGAGAAGGAGG - Intergenic
963590709 3:147254539-147254561 CCATTGCATCAAACAGAATGTGG - Intergenic
968123655 3:196143284-196143306 CCACAGCCACAGAGAGAAGGAGG + Intergenic
969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG + Intergenic
971773901 4:30934874-30934896 ACATTTCCAGAAAGAGAACCTGG + Intronic
980203994 4:129694013-129694035 CCATTGCAACAAAGGGCAGGAGG - Intergenic
982969541 4:161966070-161966092 TTATTGCCACAAAGACAACTTGG + Intronic
983877719 4:172896577-172896599 CAATTGCAACAAGGAGAACTTGG + Intronic
985393899 4:189520967-189520989 TCATTTCCATAAAGAGAACTAGG - Intergenic
989162707 5:38406973-38406995 CCATTCCCATACAGAGAAAGGGG + Exonic
991356116 5:65770520-65770542 CCATATCCACAAAGATAACTTGG - Intronic
992020783 5:72621603-72621625 CCATTGCCACAGAGAGCAAAAGG - Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1004989801 6:21124656-21124678 CAATGGCCACAAAGAGAACGAGG + Intronic
1005002242 6:21253581-21253603 CAAGTGGCACAAAGAGAAGGGGG + Intergenic
1005273824 6:24195273-24195295 CAATTCCCACAATGAGAAGGGGG + Intronic
1011258221 6:85445732-85445754 CTATGGCCACAAAGAGATCACGG + Intergenic
1012521246 6:100123977-100123999 CCATAGCCTCAATGAGAAAGTGG - Intergenic
1012858503 6:104530551-104530573 CCATTGCCCTAAAGAGAAATAGG - Intergenic
1017781177 6:157716497-157716519 CCAGTGCCACAGGAAGAACGTGG - Intronic
1017994239 6:159518303-159518325 ACATTGCAACTAAGAGAACTAGG - Intergenic
1018441520 6:163818101-163818123 TCATTGCCACAATGAAAATGTGG + Intergenic
1019581437 7:1765488-1765510 CCATTGTCACACAAAGCACGAGG - Intergenic
1021762231 7:23913268-23913290 CCAAGGCCACATAGAGAAGGGGG - Intergenic
1022805195 7:33814428-33814450 CCAGTGACACAGAGAGAACTGGG - Intergenic
1027800554 7:82744639-82744661 CTATTGAAACAAAGAGAAGGAGG - Intergenic
1028697377 7:93730826-93730848 CCATGTGCACAAAGAGAAAGGGG + Intronic
1029219036 7:98973529-98973551 CCATGGCCCCACAGAGGACGTGG - Intronic
1035549046 8:506069-506091 CCACTGCCACAAAGACAGAGGGG + Intronic
1036669510 8:10772060-10772082 CTAATCCCACAAAAAGAACGTGG - Intronic
1038431980 8:27507657-27507679 CCATTGCCTCAAAGGGAAGTAGG + Intronic
1039976508 8:42371049-42371071 TCAGTGCCACAAAGGGAACCTGG - Intronic
1041963615 8:63648785-63648807 ATATTGCCAAAAAGAGAACGGGG + Intergenic
1043561558 8:81499668-81499690 CCAGTGCCAGAGAGAGAATGAGG - Intergenic
1044307098 8:90650391-90650413 CCATAGCCACACAGAGAAAGTGG + Intronic
1050623449 9:7478447-7478469 CCCATTTCACAAAGAGAACGAGG + Intergenic
1054752081 9:68917607-68917629 CCATTCCCTCAAAGAGAAAGAGG + Exonic
1059522908 9:114960729-114960751 CCATGGGCACAAGGACAACGAGG - Intergenic
1203775293 EBV:69579-69601 CCATCGCCCCACAGAGAAAGAGG - Intergenic
1187122893 X:16426394-16426416 CCAATCCCACAAAGAGAAGAAGG + Intergenic
1187205733 X:17179257-17179279 CTATTTCCACAAATAGAATGTGG + Intergenic
1188174899 X:26977206-26977228 CCATCGCCAAAAAGAGAAAGAGG - Intergenic
1189173637 X:38932791-38932813 TCATTACCAAAAAGAGAACCAGG - Intergenic
1191805982 X:65134261-65134283 GACTTGCCACCAAGAGAACGTGG + Intergenic
1193031902 X:76907535-76907557 CCCTTGCCAGAAAGAGAAATTGG + Intergenic
1195808675 X:108804382-108804404 CCATTGGCACAAAGAGGAGCTGG + Intergenic
1198127722 X:133662746-133662768 CCATTGCCAAAGAGAGAAAAAGG + Intronic
1200959864 Y:8986754-8986776 CCATTCCCACAAAAAAAACTAGG + Intergenic