ID: 1004989801

View in Genome Browser
Species Human (GRCh38)
Location 6:21124656-21124678
Sequence CAATGGCCACAAAGAGAACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004989798_1004989801 0 Left 1004989798 6:21124633-21124655 CCTCGTTCTCTTTGTGGCAATGG 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1004989801 6:21124656-21124678 CAATGGCCACAAAGAGAACGAGG No data
1004989796_1004989801 22 Left 1004989796 6:21124611-21124633 CCTGTAATTTATCTGGGTTTGAC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1004989801 6:21124656-21124678 CAATGGCCACAAAGAGAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004989801 Original CRISPR CAATGGCCACAAAGAGAACG AGG Intronic
No off target data available for this crispr