ID: 1004989803

View in Genome Browser
Species Human (GRCh38)
Location 6:21124678-21124700
Sequence GTCAAATCTAGATAAATTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004989802_1004989803 -7 Left 1004989802 6:21124662-21124684 CCACAAAGAGAACGAGGTCAAAT 0: 1
1: 1
2: 0
3: 11
4: 181
Right 1004989803 6:21124678-21124700 GTCAAATCTAGATAAATTATAGG 0: 1
1: 0
2: 0
3: 22
4: 243
1004989798_1004989803 22 Left 1004989798 6:21124633-21124655 CCTCGTTCTCTTTGTGGCAATGG 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1004989803 6:21124678-21124700 GTCAAATCTAGATAAATTATAGG 0: 1
1: 0
2: 0
3: 22
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004989803 Original CRISPR GTCAAATCTAGATAAATTAT AGG Intronic
900758228 1:4452428-4452450 GTCAATTCTAAATCAATTAAAGG - Intergenic
903913363 1:26745174-26745196 GTCAAATCTAGGTTAAATCTGGG - Intronic
905381251 1:37562929-37562951 GGCAAAGCAAGACAAATTATTGG + Intronic
908135222 1:61125227-61125249 GTCACATGTGAATAAATTATTGG - Intronic
909106558 1:71417144-71417166 GTAAAATATAGATGAAGTATAGG - Intronic
910700073 1:90063863-90063885 CTCAAATTTAGATAAATTAGAGG + Intergenic
912093421 1:106110542-106110564 ATAAAATATAGATAAATTATTGG - Intergenic
912236990 1:107863056-107863078 GTAAAATATACATAAATTAAGGG + Intronic
918579642 1:186110924-186110946 GTCAAATTTGGAAGAATTATAGG + Intronic
918649477 1:186943508-186943530 GTCAGGTCTAGGTATATTATAGG - Intronic
919066815 1:192702237-192702259 ATCATATCTGTATAAATTATTGG + Intergenic
919306186 1:195841446-195841468 GACAAATATAAATAAATTAGAGG + Intergenic
919378133 1:196819075-196819097 GTCAAATCAAGAATAATTTTTGG - Intergenic
919387827 1:196943113-196943135 GTCAAATCAAGAATAATTTTTGG - Intronic
919997626 1:202767942-202767964 GTAAAATCTAGAAAACATATTGG - Intronic
921440512 1:215180992-215181014 GCAAAATCTAAAAAAATTATTGG - Intronic
921765077 1:218962477-218962499 GGCAAGTCTAGAGAAAATATTGG + Intergenic
924010692 1:239662481-239662503 TTCAAATTTTGATAAAATATTGG + Intronic
1063751475 10:8953515-8953537 GTCTAATCTATATAAAATAAAGG + Intergenic
1065066758 10:21975937-21975959 GTTTCTTCTAGATAAATTATGGG + Intronic
1065586862 10:27227251-27227273 GACAGACCTAGAAAAATTATGGG - Intronic
1066091752 10:32028867-32028889 ATCAAATCTAGTTAAATTTGAGG - Intronic
1066205785 10:33188081-33188103 ATCACATCTTGATAAATTAGTGG - Intronic
1068357674 10:55930943-55930965 GTCAATTTTACATAATTTATAGG - Intergenic
1068412416 10:56674280-56674302 TTCAAATCAAGATATATTCTAGG + Intergenic
1068743727 10:60504359-60504381 GCCAAATTTAGAGAAATTAAAGG + Intronic
1069163424 10:65118431-65118453 TTCATATCTGGAGAAATTATAGG - Intergenic
1069337909 10:67375254-67375276 GCAATATCTGGATAAATTATTGG + Intronic
1071377114 10:85018189-85018211 GTCAAATGTAAAAAAATAATTGG + Intergenic
1073055560 10:100698520-100698542 ATCAAATATTGATAATTTATTGG - Intergenic
1074634553 10:115299368-115299390 GTCAATCTTAGTTAAATTATAGG + Intronic
1076471062 10:130718682-130718704 TTAAAATCTAGATATGTTATTGG - Intergenic
1077891425 11:6420662-6420684 GTCAAATCATTATAAACTATTGG - Intergenic
1078116010 11:8451565-8451587 GGCAAATCTAGAGAGATTAGTGG + Intronic
1078984793 11:16582706-16582728 TTTAAATCTAGATAAAATAGTGG + Intronic
1079858771 11:25641166-25641188 TGCATATCTAGATAAATTTTTGG + Intergenic
1079977441 11:27109459-27109481 CTCAAATCTAGAAAAAGTCTTGG - Intronic
1080987623 11:37488716-37488738 GTCATATCTAGATATTTCATTGG + Intergenic
1081708504 11:45201190-45201212 GTCAAATGTAGTAAAATAATTGG + Intronic
1082737006 11:56866772-56866794 GCCAAATCAAGATTAATTTTGGG - Intergenic
1085982415 11:81740723-81740745 GTCATATCTTAAAAAATTATAGG + Intergenic
1086208722 11:84292626-84292648 GTCAAACCCAGATAAGATATAGG - Intronic
1086595480 11:88566076-88566098 CTAAAATCTAGATAAATAAATGG - Intronic
1086666755 11:89492317-89492339 GTTAAATCTAGAAAAGTTATTGG - Intronic
1090565887 11:127991767-127991789 GTCCAATCAAGATAATTCATTGG - Intergenic
1092681140 12:10982353-10982375 GTCAAAACCAGATGGATTATAGG + Intronic
1092684025 12:11020636-11020658 GTGAAATCTATATAATTGATAGG - Intronic
1094332743 12:29313537-29313559 TACAAATCCAGATAATTTATAGG - Intronic
1095633056 12:44400378-44400400 GTCAGATCTATAGAAAATATAGG + Intergenic
1096657398 12:53100158-53100180 CTCAAAAATAAATAAATTATTGG - Intronic
1097943401 12:65338351-65338373 GTCAAATGTAGTTAAATAATTGG + Intronic
1098076703 12:66739268-66739290 GTAAAATTGAGATAAATTATAGG - Intronic
1098408397 12:70151955-70151977 GCCAAATCGAGATTAATTTTGGG - Intergenic
1098776586 12:74628014-74628036 ATCAAATCGAGATAGATTAAAGG - Intergenic
1099496107 12:83348414-83348436 GTAAAATCTCAATAAATTATTGG - Intergenic
1099869204 12:88325327-88325349 GCCAAATAGAGATAACTTATGGG - Intergenic
1101571471 12:105957787-105957809 GTCAAATTGAGTTAAATTCTAGG - Intergenic
1105835325 13:24205921-24205943 ATCAACTCAAGATAAATTAAAGG + Intronic
1106656179 13:31749185-31749207 CTCAATTCTAGATAGATAATAGG - Intronic
1109382891 13:61587581-61587603 GACAAATTTAAATAAATAATTGG + Intergenic
1109623086 13:64935670-64935692 GTCAAATCTAGTTATATTCTAGG - Intergenic
1110104387 13:71652957-71652979 CTCAAATTTGGATAAATTGTTGG - Intronic
1110837782 13:80104698-80104720 TACAAATATAGATAAGTTATGGG - Intergenic
1111921243 13:94413445-94413467 ATTAAATGTAAATAAATTATTGG - Intergenic
1114960793 14:27886208-27886230 ATCAAATATAGATATCTTATAGG + Intergenic
1115464885 14:33704158-33704180 GTGAAATCTAGAGAATTTTTAGG + Intronic
1116399866 14:44493342-44493364 GGCAAATCTAGAGATATTTTTGG + Intergenic
1118704684 14:68469903-68469925 GTCAAATCTGGATAACTTTTGGG + Intronic
1119245119 14:73097932-73097954 GATAAACTTAGATAAATTATAGG + Intronic
1120355196 14:83424564-83424586 GTAAAATCAAGTTACATTATGGG - Intergenic
1124008367 15:25812561-25812583 GTCGATTGTAGATAAATTAAAGG - Intronic
1125229671 15:37438876-37438898 GTCAATTTAAAATAAATTATTGG - Intergenic
1126923436 15:53554013-53554035 GTCAAAATTAGACATATTATAGG - Intronic
1127146907 15:56034311-56034333 GGCAAATTTAGGAAAATTATTGG - Intergenic
1127788553 15:62378103-62378125 TTCACCTCTAGATAAATTACTGG - Intergenic
1127917738 15:63469206-63469228 GTAAAATGAGGATAAATTATGGG + Intergenic
1130828110 15:87570530-87570552 GGCAAATGAAGATAAATTATAGG - Intergenic
1131163266 15:90123453-90123475 ATCAATTCTAGATTAATTATAGG - Intergenic
1131917500 15:97285700-97285722 GTCAAATGTGCATATATTATAGG + Intergenic
1137733118 16:50704101-50704123 GTCAAATATAGATAAAGGTTAGG + Intronic
1139721995 16:68863773-68863795 ATTAAAACTAGATATATTATTGG + Intronic
1140591132 16:76353998-76354020 ATCAAAACTATATAAATTAATGG + Intronic
1140596654 16:76423953-76423975 GTCAAATCTAGATTTTTTAATGG - Intronic
1147003883 17:37386123-37386145 TTCAAAGCTAGAAAAATTACCGG - Exonic
1148983784 17:51602568-51602590 GTCAAAATTAATTAAATTATTGG + Intergenic
1149805643 17:59615572-59615594 TTCAATTCTAGACAAATTAAAGG - Intergenic
1153750332 18:8222921-8222943 CTCAAAAATAGATAAATAATAGG + Intronic
1155783402 18:29868886-29868908 GTAAAATATAGAAAAAGTATTGG - Intergenic
1156009862 18:32484287-32484309 GTGAAAGGTAAATAAATTATTGG - Intergenic
1156162710 18:34379451-34379473 GCCTAATATAGTTAAATTATTGG - Intergenic
1159713148 18:71788755-71788777 TGCAAATCTATTTAAATTATTGG + Intergenic
1164629534 19:29753065-29753087 CTCGATTCTTGATAAATTATTGG + Intergenic
1164843043 19:31408761-31408783 GTGAAATCTGGATAAACTAAAGG - Intergenic
924962009 2:44330-44352 GTCATAGCCAGAGAAATTATTGG + Intronic
926574799 2:14568257-14568279 GTGAAAAATAAATAAATTATTGG + Intergenic
926775911 2:16423030-16423052 TGCAAATCTAGATAAATCAATGG - Intergenic
930297256 2:49570312-49570334 GTTAAAAGTAGATAAATTCTGGG + Intergenic
930373156 2:50530520-50530542 CACCAATCTAGATGAATTATGGG - Intronic
930618439 2:53618752-53618774 ATAAAATAGAGATAAATTATGGG + Intronic
931739848 2:65232067-65232089 TTAAAATCCACATAAATTATTGG - Intronic
933440579 2:82308333-82308355 GTCAACTCAAAATAAATTAAAGG + Intergenic
933499013 2:83088742-83088764 GGCAATTCTAGATAAGTTCTAGG - Intergenic
935894921 2:107725321-107725343 GTTAAATCTACAAAAATTAGAGG + Intergenic
936629336 2:114184352-114184374 GTCATAACTTGAAAAATTATTGG - Intergenic
939076940 2:137614597-137614619 GTAAAATAGTGATAAATTATTGG + Intronic
939147417 2:138432647-138432669 AAGAAATCTAAATAAATTATTGG - Intergenic
939444953 2:142297377-142297399 GTGAAACTTAGATAAATTACTGG + Intergenic
939899527 2:147835235-147835257 GTGAAATGTAGAGAAATTAAGGG - Intergenic
940284638 2:152021356-152021378 TTCAAATTTAAAAAAATTATAGG + Intronic
940413840 2:153397545-153397567 GTAACATCTAGTTAAAATATTGG - Intergenic
940421189 2:153480499-153480521 TTCAATTCTAATTAAATTATGGG - Intergenic
940459214 2:153941022-153941044 ATAAAATCTAGATAAAGTTTAGG - Intronic
942618481 2:177820788-177820810 GTCAAATCTAGATACAAAAAAGG + Intronic
942636069 2:178007537-178007559 TTTAAATATAGATAAAATATTGG + Intronic
943820740 2:192316779-192316801 GTCAAATGTACTAAAATTATAGG - Intergenic
943925983 2:193780633-193780655 GTTTAATGTAGATATATTATTGG - Intergenic
945751743 2:213794921-213794943 GCCAAATTTAAATAAATTTTAGG - Intronic
946044786 2:216811885-216811907 GTCAATTAAAGATAAAATATTGG + Intergenic
946722697 2:222627241-222627263 GTCAAATCTAGCCAAATGACTGG + Intronic
947399508 2:229716951-229716973 CTAAAATCAAGATACATTATTGG - Intergenic
1169978544 20:11357853-11357875 GCAAAATATAAATAAATTATTGG - Intergenic
1170913901 20:20603771-20603793 ATCAAATCAAGATAAATAAGTGG + Intronic
1176521289 21:7826413-7826435 GTCAATCCTAGATAAACTAGAGG + Intronic
1177591266 21:23171047-23171069 GGCAAATAAAGATAAAATATCGG - Intergenic
1177946661 21:27479149-27479171 GTCTTATCTAAATAAGTTATGGG + Intergenic
1178655309 21:34456425-34456447 GTCAATCCTAGATAAACTAGAGG + Intergenic
1180641520 22:17303169-17303191 GACAAATACAGATAATTTATGGG + Intergenic
1181336922 22:22142856-22142878 GTAAAATTTACATAAATTCTTGG + Intergenic
1182244080 22:28941502-28941524 GACAAATATAGATAAAATCTTGG + Intronic
1184590590 22:45479752-45479774 TACAAATATAGATAAAATATTGG - Intergenic
950600587 3:14031783-14031805 GCCAAATCAAGATTAATTTTGGG + Intronic
950848361 3:16036997-16037019 GTAAAATCTAGACACATTTTGGG - Intergenic
951083968 3:18488459-18488481 GACAAATCTATATAATGTATAGG - Intergenic
951259945 3:20495684-20495706 GACAATTCTAGACAAATTCTGGG - Intergenic
952363836 3:32657451-32657473 GTCAAATCTAGAGAAACTCTAGG + Intergenic
952719129 3:36514122-36514144 GTAAAATCTAGAATATTTATGGG + Intronic
953591327 3:44257908-44257930 GCCAAAACTATAGAAATTATTGG - Intronic
956912556 3:73834332-73834354 CTCAATTCTAGATTGATTATGGG + Intergenic
957128348 3:76192008-76192030 TTGCAATCTAGAAAAATTATTGG + Intronic
957911908 3:86629708-86629730 ATTAAATTTAGAAAAATTATGGG - Intergenic
958880192 3:99660608-99660630 TTCATAGCTAGAGAAATTATAGG - Intronic
959187453 3:103063826-103063848 GTCAATTCTAAATAACATATAGG + Intergenic
959230573 3:103645855-103645877 GTCAAATCTTGACACATTACAGG + Intergenic
963588193 3:147221753-147221775 GTAAATTCCAGATAAATTCTAGG - Intergenic
964921554 3:161902680-161902702 GGGAAATCTAGATAGATTACGGG - Intergenic
965102796 3:164322957-164322979 GTCAAATCTGGGACAATTATGGG + Intergenic
967513481 3:190339855-190339877 GTGAAATCAAGAAAAACTATAGG + Intronic
970412931 4:15827523-15827545 GTAAAATCTAAAAAAATTAATGG - Intronic
971731252 4:30384363-30384385 GTCAATTATAGATAACTTTTAGG - Intergenic
971765684 4:30827801-30827823 GTCAATTCTGGAAAACTTATTGG + Intronic
971952345 4:33369587-33369609 TTCAATTCTAGATAAATTTTAGG - Intergenic
972149587 4:36072457-36072479 GGCAAAGCAAAATAAATTATTGG - Intronic
974711789 4:65607020-65607042 CTCAAAACTACATAAAATATAGG + Intronic
975741500 4:77433552-77433574 GGCAAAGGTGGATAAATTATGGG - Intergenic
977087183 4:92616547-92616569 GAAAAATCTAAAGAAATTATGGG - Intronic
977529686 4:98185218-98185240 GTCATTTCTAGACAAATTACTGG + Intergenic
978493829 4:109337905-109337927 GACAGTTCTAAATAAATTATAGG - Intergenic
979094344 4:116527249-116527271 CTAAAATCTTAATAAATTATAGG + Intergenic
979100102 4:116602381-116602403 CCCAAACCTAGATAAATTATGGG - Intergenic
979899228 4:126196871-126196893 ATCAAATCAAGATAGATTAAAGG - Intergenic
980573933 4:134661282-134661304 GATAAATGTAGATAAATTCTTGG + Intergenic
980836918 4:138205957-138205979 TTCAAGCCTAGATAAATTTTTGG - Intronic
982173346 4:152682508-152682530 AACAAATCCAGATAAATGATAGG + Intergenic
984048429 4:174832580-174832602 AGCAAATGTAAATAAATTATTGG - Intronic
984105781 4:175543477-175543499 GTTAATTCTAGATAAGATATAGG + Intergenic
984310134 4:178047370-178047392 GTAAAATCTTGATAGATTTTTGG + Intergenic
984622617 4:181971432-181971454 GCCAAATCTAGAAAAATTCATGG + Intergenic
986795246 5:11203695-11203717 GTCAAATCTTGAAAGATTTTAGG + Intronic
987571312 5:19664431-19664453 GCAAAATTGAGATAAATTATGGG + Intronic
987857422 5:23438852-23438874 CTAAATTTTAGATAAATTATAGG - Intergenic
988230289 5:28468555-28468577 AGTAAATGTAGATAAATTATTGG + Intergenic
988388867 5:30601302-30601324 ATCGAATCTAGATAGATTGTTGG + Intergenic
988639499 5:33025855-33025877 GTGAAATCAAAACAAATTATGGG + Intergenic
989577748 5:43004403-43004425 GTCAAATCTAGACAAACAAGAGG - Intergenic
989718023 5:44489594-44489616 GCAAAATCTTAATAAATTATTGG + Intergenic
990186167 5:53212295-53212317 ACCAAATCAAGATAAATTTTAGG + Intergenic
991280284 5:64905554-64905576 TTCAAATTTACATAAATTATGGG - Intronic
991969723 5:72127856-72127878 GTTAATTCTAGATAAATTTTAGG - Intronic
992925207 5:81576751-81576773 CTTAACTCTAGATAAATTAAAGG + Intronic
992990891 5:82282311-82282333 ATCAACTCTGGATAAATTAAGGG + Intronic
993362741 5:86998200-86998222 GTCAATTCTAGATTGATTACTGG - Intergenic
993586386 5:89735387-89735409 GTGAAATGTAGAAAAAGTATTGG - Intergenic
993628422 5:90254166-90254188 GTCATAACTATATAAATGATTGG - Intergenic
994078606 5:95681278-95681300 GTCAAATAAATATAAATTACAGG - Intronic
994541370 5:101102335-101102357 GTGAAATATAGATAATATATTGG - Intergenic
994646226 5:102472084-102472106 GTGAAATCTAGATAGAGTACAGG + Intronic
996066134 5:119081269-119081291 GTCAAATCCAGATGACTTCTTGG + Intronic
997005151 5:129807786-129807808 TTCAGATATAGATAAATTAATGG - Intergenic
999452089 5:151686144-151686166 TTCAGATCTAGATAAACTAAGGG + Intronic
1000480011 5:161761773-161761795 ATGAAATCTTGACAAATTATTGG - Intergenic
1003341945 6:5229932-5229954 GTTTAATTTTGATAAATTATAGG - Intronic
1004989796 6:21124611-21124633 GTCAAACCCAGATAAATTACAGG - Intronic
1004989803 6:21124678-21124700 GTCAAATCTAGATAAATTATAGG + Intronic
1005242855 6:23852721-23852743 GTTATAGCTTGATAAATTATAGG - Intergenic
1006994096 6:38241942-38241964 GTCAAATCTAGATTATCTAGGGG - Intronic
1007218767 6:40262199-40262221 TACAAATCCAGATAAATTCTAGG + Intergenic
1009218563 6:60953680-60953702 CTCAAATTTAGCTAAATTTTAGG + Intergenic
1010879141 6:81146580-81146602 GTCAAATTTTGGAAAATTATTGG - Intergenic
1010932131 6:81816108-81816130 GGCAAATCTTTCTAAATTATAGG - Intergenic
1011317299 6:86050096-86050118 ATCAACTCAAGATGAATTATAGG - Intergenic
1011934720 6:92761539-92761561 GTAAAATAAAGATAAATTCTAGG + Intergenic
1012046842 6:94286643-94286665 GTCCAAACTAGAGAAGTTATAGG + Intergenic
1012640433 6:101604708-101604730 TACATATCTAAATAAATTATTGG - Intronic
1014087767 6:117367327-117367349 GTCAATTCTGGATAAATGCTTGG - Intronic
1014777243 6:125525411-125525433 TTCAACTCTAGATAAAAAATAGG + Intergenic
1014825603 6:126046092-126046114 GAGAATTCTAGATAAATTCTTGG + Intergenic
1015361553 6:132345179-132345201 GTCAATTCCAGGTAAATTTTAGG + Intronic
1016073292 6:139766744-139766766 GTCTAATATATATAATTTATGGG + Intergenic
1016093656 6:140009928-140009950 GTCATGTATAGATAAAATATAGG + Intergenic
1016850245 6:148611798-148611820 CTCAAATATAGAGAAATTACTGG - Intergenic
1019052715 6:169195676-169195698 GTCAACTCAAGATAGATTAAAGG - Intergenic
1020424234 7:8045684-8045706 GCCACATCTACATATATTATAGG - Intronic
1021587683 7:22227130-22227152 GTCAAAACAAGAGAAAATATTGG - Intronic
1021832690 7:24632209-24632231 TTCAGATCAAGAAAAATTATTGG - Intronic
1023718470 7:43068345-43068367 GTTGAATATAGATAAATTTTTGG - Intergenic
1024574008 7:50749081-50749103 GTCAATTCTATATAAAATGTTGG + Intronic
1025479721 7:60966863-60966885 GTCACATCTAGAAACATAATGGG + Intergenic
1025921607 7:65918522-65918544 GTCAAACCTAGAGAAATGAATGG + Intronic
1026276367 7:68880950-68880972 TTGAAATGTAGATAAATTCTAGG + Intergenic
1027968465 7:85044048-85044070 CTTAAATATAAATAAATTATTGG - Intronic
1028038512 7:86017892-86017914 GTCATATCTAGAGATATTTTTGG - Intergenic
1028305699 7:89261376-89261398 GACAAATATATATAAAATATAGG - Intronic
1028572689 7:92308434-92308456 ATCAATTCTACATAAACTATAGG - Intronic
1028783381 7:94763719-94763741 GTCTCCTGTAGATAAATTATGGG - Intergenic
1031571980 7:123370260-123370282 GTTAAATCTAGATGAATGGTTGG - Intergenic
1032873081 7:136007372-136007394 GTCAAAATTAGCTAACTTATGGG - Intergenic
1033722141 7:144072211-144072233 GTGAAATCCAGATGGATTATGGG + Intergenic
1035993487 8:4518813-4518835 ATAAAATCTAAGTAAATTATAGG + Intronic
1036271771 8:7311350-7311372 TTCAAATTTAGATAAACTAATGG + Intergenic
1036349577 8:7998996-7999018 TTCAAATTTAGATAAACTAATGG - Intergenic
1039940685 8:42087995-42088017 ATAATATCTAGATAAAATATGGG + Intergenic
1040991868 8:53360731-53360753 GCAGAATTTAGATAAATTATAGG - Intergenic
1041132470 8:54716194-54716216 GTGCACTTTAGATAAATTATGGG - Intergenic
1041293013 8:56325187-56325209 GTCAAATCTACATAAATGAGCGG - Intergenic
1041920136 8:63172738-63172760 GTCAAATCAAGATAGAACATGGG - Exonic
1042096219 8:65218516-65218538 GTCAAATTGAGATAAATTGTAGG + Intergenic
1042452876 8:68969587-68969609 TTCAAATCTAGTTCCATTATTGG - Intergenic
1045412522 8:101932854-101932876 GTCAAGTATATATAAATTATAGG + Intronic
1045947520 8:107813150-107813172 AGAAAAGCTAGATAAATTATAGG + Intergenic
1046103514 8:109641722-109641744 GTTAAATGTAGAAAAAATATTGG - Intronic
1047031910 8:120891166-120891188 GTCAAATCTTGATTATTTATAGG + Intergenic
1048093974 8:131271272-131271294 GTAAAATCTAGGAAAATCATAGG - Intergenic
1048742079 8:137572347-137572369 GTAAAATTGAGATGAATTATAGG - Intergenic
1050912685 9:11092831-11092853 GTCAAACCTAGATGAATATTTGG + Intergenic
1051065313 9:13095104-13095126 ATCAAGTCTAGATAAAATTTGGG + Intergenic
1052688671 9:31786179-31786201 GTCAGAAATAAATAAATTATAGG + Intergenic
1053486847 9:38465037-38465059 CTCAAATTTAGAAAAATTTTGGG + Intergenic
1055204069 9:73706341-73706363 GTAAAATCTAGAAACATTACTGG - Intergenic
1055267287 9:74510184-74510206 GTCAAATTTAGTCAAATTGTGGG - Intronic
1055748463 9:79477039-79477061 GTCACATATAGATAAATCATAGG + Intergenic
1058232265 9:102441566-102441588 GTCAAAGCTAGAGAATATATAGG + Intergenic
1059952369 9:119479204-119479226 GTGAAATGTAGAGAATTTATAGG + Intergenic
1187741283 X:22358442-22358464 GTCAAGACTAGGTAAACTATGGG - Intergenic
1187998034 X:24950154-24950176 TGCAAATCTGGATAAATTAATGG - Intronic
1190569880 X:51770215-51770237 GTCAAATCAAGATTAATTTGGGG - Intergenic
1192704783 X:73518306-73518328 GTCTCATCTAGATTAAATATGGG + Intergenic
1193556861 X:82964560-82964582 ATCAACTCAAGATAAATCATAGG - Intergenic
1193713624 X:84909454-84909476 TCCAGATCTAGGTAAATTATGGG + Intergenic
1194166691 X:90524433-90524455 GTCAAATCAGGATTAATTTTGGG - Intergenic
1194250178 X:91564626-91564648 GTCAGATTTAGTTAAATTGTAGG - Intergenic
1197695743 X:129547879-129547901 GTCAAATCCAGAGAAATCAGAGG + Intronic
1198639642 X:138742593-138742615 GACAAATCCAGTTAAATTTTTGG + Intronic
1200420606 Y:2962144-2962166 TTCAAACCTAAATAAATTAGTGG - Intronic
1200425161 Y:3012536-3012558 ACCAAATCAAGATAAATTTTAGG + Intergenic
1200512960 Y:4102211-4102233 GTCAAATCAAGATGAATTTTGGG - Intergenic
1200569140 Y:4805875-4805897 GTCAGATTTAGTTAAATTGTAGG - Intergenic