ID: 1004991022

View in Genome Browser
Species Human (GRCh38)
Location 6:21138898-21138920
Sequence AAGGGCACACAGAAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 789
Summary {0: 1, 1: 1, 2: 4, 3: 63, 4: 720}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004991022_1004991024 -9 Left 1004991022 6:21138898-21138920 CCTTTCTCCTTCTGTGTGCCCTT 0: 1
1: 1
2: 4
3: 63
4: 720
Right 1004991024 6:21138912-21138934 TGTGCCCTTCTTGCTGCTTATGG 0: 1
1: 0
2: 0
3: 20
4: 184
1004991022_1004991027 -3 Left 1004991022 6:21138898-21138920 CCTTTCTCCTTCTGTGTGCCCTT 0: 1
1: 1
2: 4
3: 63
4: 720
Right 1004991027 6:21138918-21138940 CTTCTTGCTGCTTATGGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004991022 Original CRISPR AAGGGCACACAGAAGGAGAA AGG (reversed) Intronic
900704730 1:4073251-4073273 AAGGGGAAAAAGAAGGAGAGTGG + Intergenic
901688848 1:10959704-10959726 AAGGGCTTCCAGAAGCAGAAAGG + Intronic
901798962 1:11696215-11696237 AAGGGGAGACAGAGGGAGTAAGG - Intronic
902393741 1:16120820-16120842 AAGGTCACAAAGATGGATAAGGG - Intergenic
903267441 1:22166313-22166335 AAGGTCACACAGCAGGTGAGTGG + Intergenic
903365774 1:22804781-22804803 AAGAGGACACTGAAGGAGCAGGG - Intronic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
904785966 1:32983261-32983283 AAGGGCAGAGAGAAGGGCAAGGG + Intergenic
904814614 1:33186268-33186290 AAAGGCACAAAAAATGAGAACGG - Intergenic
905284765 1:36872049-36872071 AAGGTCACACAGCAGGAAAGTGG + Intronic
905431263 1:37925819-37925841 AATGGCCCAAAGAAGGAAAATGG + Intronic
905622456 1:39460362-39460384 TGGAGCACACAGAATGAGAATGG - Intronic
905714298 1:40134869-40134891 AAGGAGACAGAGAAGGAGAAGGG - Intergenic
905780041 1:40700888-40700910 AAGGGGACACAGTGGGAGGATGG - Intronic
905788751 1:40778922-40778944 GAGGAGACACAGAGGGAGAAAGG - Intergenic
905889382 1:41510072-41510094 AGGGGTACACTGAGGGAGAAAGG - Exonic
906488944 1:46252627-46252649 TAGGGAACACAGAAGAAGAATGG + Intronic
906800472 1:48732767-48732789 AAGGGCACACTGAAGGCAATGGG + Intronic
907007149 1:50926425-50926447 AAGGGCAGTGAGAGGGAGAATGG + Intronic
907084478 1:51657292-51657314 TAGGGTACATAAAAGGAGAATGG + Intronic
907188449 1:52629818-52629840 AAGTTCACACAGAAGGTGACTGG + Intergenic
907269263 1:53281075-53281097 AAGGGCACACAGCTGGGAAATGG - Intronic
907424798 1:54372836-54372858 AGGGCCACACAGCTGGAGAACGG + Intronic
907742440 1:57180171-57180193 GAGGACACAGAAAAGGAGAAGGG + Intronic
908311197 1:62886180-62886202 AAGGTCACACAGCAAGAGAGTGG - Intergenic
908528265 1:65008670-65008692 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
909813653 1:79962762-79962784 AAAGGAAAAGAGAAGGAGAAAGG + Intergenic
910051504 1:82979267-82979289 TAGGGAACACAGTAGGAGCAAGG - Intergenic
910092413 1:83480746-83480768 AAGGGCATACAGAGGGAGACTGG - Intergenic
910199462 1:84683790-84683812 AACAGCTCAGAGAAGGAGAAAGG + Intronic
910668994 1:89754132-89754154 TAGAGGACAGAGAAGGAGAATGG - Intronic
912248793 1:107989771-107989793 AAGGGTAGACAGTGGGAGAAGGG + Intergenic
912560555 1:110548428-110548450 AAGGACAGAGAGAAGGAGAAGGG + Intergenic
912681928 1:111734240-111734262 AGGGGCAGACAGATGGAGAGGGG + Intronic
912688464 1:111785571-111785593 AAAGGCACACAGAAGGTGATAGG + Intronic
912738585 1:112172808-112172830 AAGGGGAAATAGAAGGAAAAAGG - Intergenic
914922652 1:151858055-151858077 AAATTCATACAGAAGGAGAAGGG - Intergenic
915160255 1:153914450-153914472 AAGGTCACACAGATGGTAAATGG + Intronic
915410574 1:155698614-155698636 AAGAGCACAAAGAAAGGGAAAGG - Intronic
915592244 1:156877442-156877464 AAGGGCACACAGGTAGTGAATGG + Intronic
915656514 1:157365359-157365381 GAGAGGACAGAGAAGGAGAAAGG + Intergenic
915672772 1:157504212-157504234 GAGAGGACAGAGAAGGAGAAAGG - Intergenic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
915864734 1:159486878-159486900 AAGGTCACACTCAAGGAGAGAGG - Intergenic
917193807 1:172445827-172445849 GAGGGCAGAGAGAAAGAGAAAGG + Intronic
917307272 1:173639474-173639496 AAGAGAACACAGAAGGAAAATGG + Intronic
919517117 1:198539639-198539661 AAGGTCACACAGAGGGTAAATGG - Intronic
919572032 1:199260946-199260968 AAGGACACACAGAATGAGTTAGG - Intergenic
920301387 1:204991248-204991270 ATGGCCAGACAGAGGGAGAAAGG - Intronic
920350127 1:205332383-205332405 GAGGGCACACAGAAGGACCCAGG - Intergenic
920396475 1:205649646-205649668 CAGGGCACACAAAAGGAGCCTGG - Intergenic
920541716 1:206783786-206783808 AAGGTCACACAGATGGGAAAGGG - Intergenic
920565623 1:206970446-206970468 AAGGGGACACAAGAGGAGGAAGG - Exonic
920805039 1:209224968-209224990 AAAGGGAAAGAGAAGGAGAATGG - Intergenic
920866641 1:209758880-209758902 AAAGGCACAGAGAAGGAAAAGGG + Intronic
920887064 1:209938809-209938831 AACAGCAAACAGAAGGGGAACGG - Intronic
920946838 1:210537288-210537310 ACGGGCAGACAGCAGAAGAAGGG - Intronic
921160791 1:212470839-212470861 AAGGGCACACAGCAAGCTAATGG - Intergenic
921570087 1:216767336-216767358 AAGGGCATACAGAAAGAAAGAGG + Intronic
922484033 1:225959402-225959424 AAGGCCACTCAGAAGCAGGAAGG - Intergenic
922923244 1:229326703-229326725 AAGGGAACACAGAACCACAAGGG + Intronic
923051323 1:230393097-230393119 AAGGGGAAAAAGAAGGGGAAGGG + Intronic
923106647 1:230858918-230858940 AGGGGGTCACAGGAGGAGAAAGG + Intronic
923126301 1:231037628-231037650 ATGGGCATTCAGCAGGAGAATGG - Intronic
923545385 1:234919627-234919649 AAGACCACACAGAAAGAGAGAGG - Intergenic
924170694 1:241337051-241337073 AAGATCACACAGATGGAAAATGG - Intronic
924680008 1:246221452-246221474 GTGGGCAAAGAGAAGGAGAAAGG + Intronic
1062915930 10:1241329-1241351 AAAGCCACACAAAAGGAGAAAGG - Intronic
1063518676 10:6721371-6721393 AAGGGAGCAGAGATGGAGAATGG - Intergenic
1063947060 10:11188038-11188060 AAAGACACACAAAAGGTGAAAGG - Intronic
1064749453 10:18511776-18511798 GAGGGCACCCAGATTGAGAAGGG + Intronic
1065476019 10:26138865-26138887 GAGGACACACAGAAGGAAATGGG + Intronic
1065516908 10:26532850-26532872 AAGGACAGAAAGAAGCAGAAAGG - Intronic
1066127242 10:32353277-32353299 AAGGGCAAAGAGAGAGAGAAAGG + Intronic
1067819758 10:49518365-49518387 AAGGGCTTGGAGAAGGAGAAGGG - Intronic
1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG + Intronic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1070664403 10:78333111-78333133 AATGGAGCAGAGAAGGAGAAGGG + Intergenic
1070992460 10:80744483-80744505 AAGAGAACACAGAAGGGAAATGG + Intergenic
1071315957 10:84398241-84398263 GAAGACAGACAGAAGGAGAATGG - Intronic
1071877757 10:89861295-89861317 AAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1072174865 10:92910224-92910246 AATGGCTTTCAGAAGGAGAATGG + Intronic
1072204798 10:93193752-93193774 AAGAACACACAGAAGGAACAAGG + Intergenic
1072231040 10:93414211-93414233 GGGAGGACACAGAAGGAGAAAGG - Intronic
1072340177 10:94439652-94439674 AAAGGGACACTGAAGGAGAAAGG - Intronic
1072422879 10:95304198-95304220 AAGGACACTGAGAAGGAGCAGGG + Intergenic
1073112602 10:101071578-101071600 AAGAGGACACAGAAGAAGGAAGG - Intergenic
1073185474 10:101612949-101612971 AAGACCACACAAAGGGAGAAGGG + Intronic
1073206886 10:101774371-101774393 CAGGGCCCACAAAAGGAGAGTGG - Intronic
1073400547 10:103253405-103253427 AATAGCACAAAGAAGGAGAAAGG - Intergenic
1073764313 10:106665350-106665372 AAGGGAAGGAAGAAGGAGAAAGG - Intronic
1074412468 10:113240166-113240188 GAGGGCACACACAAAGAAAATGG - Intergenic
1074532067 10:114305009-114305031 GAGGGCACACAGATGCAGGAGGG + Intronic
1074532358 10:114306031-114306053 GAGGGGACACAGATGCAGAAGGG + Intronic
1074792145 10:116900490-116900512 AAAGGCAGACAAAAGGAGGAAGG + Intronic
1074889371 10:117722441-117722463 AGAGGTACATAGAAGGAGAAGGG + Intergenic
1075284483 10:121171785-121171807 AAGGGAAGGCAGAAGGGGAAGGG + Intergenic
1075316142 10:121455167-121455189 AAGGCCACCAGGAAGGAGAAGGG - Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075345914 10:121681880-121681902 AAAGGCACACAGAGGCAGGATGG - Intergenic
1075364110 10:121867690-121867712 AAGTGCACAGAAAAGTAGAAAGG - Intronic
1075909353 10:126110489-126110511 AAGAGCAAAGAGAAAGAGAACGG + Intronic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077428395 11:2499017-2499039 GAGGGCACACAGAAGCAGGTGGG - Intronic
1077860822 11:6178272-6178294 CAGGCCACACAGAAGGAGTTGGG + Intergenic
1077974027 11:7227006-7227028 AATGGCACGCAAAATGAGAACGG - Intergenic
1078143805 11:8709678-8709700 AAGGTCATACAGAACCAGAAGGG - Intronic
1078191678 11:9096392-9096414 ATGGGCACAGAGGAAGAGAATGG - Intronic
1078241404 11:9534006-9534028 AAGGGCAAGCAGGAGGGGAAGGG - Intergenic
1078402857 11:11043773-11043795 AAGGGCACACAGCTGGAGAGTGG + Intergenic
1078435117 11:11318325-11318347 GAGGTCACACAGAAGTAGAATGG + Intronic
1078910733 11:15729446-15729468 AAGGACACAGAGAAAAAGAATGG + Intergenic
1079154530 11:17932598-17932620 AAGGAGCCATAGAAGGAGAAAGG + Intronic
1079251780 11:18792200-18792222 ACAGGCAGACAGAAGGAGTAGGG + Intronic
1079551477 11:21704243-21704265 AAGGACAAACATAAGGAGAGGGG - Intergenic
1079788503 11:24706516-24706538 AAGGCCGCACAGGAAGAGAATGG - Intronic
1080027000 11:27625698-27625720 AAGGTCATATTGAAGGAGAAAGG - Intergenic
1080157406 11:29127913-29127935 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
1080515730 11:33017697-33017719 CAGAGCACACAGAAAGAGAATGG - Intronic
1080885785 11:36366874-36366896 AAGGGGAGAAAGAAGGAGAGAGG - Intronic
1080945121 11:36964139-36964161 AAGAAGACACAAAAGGAGAATGG + Intergenic
1081760544 11:45573870-45573892 AAGGTCACACAGCAGGTGACTGG + Intergenic
1082798045 11:57392666-57392688 GAGGTCAAACAAAAGGAGAAGGG + Intronic
1082958462 11:58896622-58896644 AAGGACACAAAGATGGAGTAGGG + Intronic
1083266592 11:61549867-61549889 AAGGGCCCACAAGAGGAGACAGG - Intronic
1083441002 11:62676556-62676578 AAGGGGTCACAGAGGGACAATGG + Exonic
1084651441 11:70491770-70491792 GAGGGCACACAGCTGGAAAAGGG - Intronic
1085007161 11:73102693-73102715 AAGGGCAAAAAGAGAGAGAAGGG - Intronic
1085535817 11:77216743-77216765 AAAGGCACACAGAAGGGCCACGG - Exonic
1086738705 11:90340320-90340342 AAGGCCACACAGAAAAGGAATGG - Intergenic
1087566598 11:99867657-99867679 AAGGGCCCTCAAAAGTAGAAGGG - Intronic
1088681947 11:112251209-112251231 AAGGCCACACAGAAAGTAAATGG - Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089863921 11:121615366-121615388 AAGGACACCAAGGAGGAGAAAGG - Intronic
1090076673 11:123584222-123584244 AAGGGCACACAGACAGCGGAGGG - Intronic
1090478524 11:127046900-127046922 TAGGGCCCACAGTAGGAGAGGGG + Intergenic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1090970301 11:131636653-131636675 CAGAGCCCACGGAAGGAGAATGG + Intronic
1091192573 11:133707356-133707378 AAGGGGAAAGAGAAGGGGAAAGG + Intergenic
1091227579 11:133966727-133966749 AAGGGCACGAAGGAAGAGAAGGG + Intergenic
1091888494 12:4033615-4033637 AAGATCACAGAGAAGGAAAAAGG - Intergenic
1091896473 12:4109241-4109263 AAGGGCACAGAGGAGGAGAGAGG + Intergenic
1092461146 12:8687417-8687439 AAGTGACCACAGAAGGAGGATGG - Intronic
1092828840 12:12424134-12424156 AAAGGAAAACAGAAAGAGAAAGG - Intronic
1093209373 12:16289340-16289362 AAGGGAACAGACCAGGAGAAAGG + Intergenic
1093956772 12:25229326-25229348 AAAGGCACACATAAGGAAATGGG + Intronic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1095113055 12:38319145-38319167 GAGGACACAGAGAAGGAGCAGGG + Intronic
1095319740 12:40812752-40812774 AAGGGCACATACAAAGTGAAGGG - Intronic
1095922101 12:47542030-47542052 AGAGGAACACAGAAGGAGTATGG + Intergenic
1096401345 12:51309284-51309306 AAAGACACACAGGAGGAAAAAGG - Intronic
1096716326 12:53493472-53493494 CAGGGCACAGAAAAGGCGAAAGG + Intronic
1096811441 12:54172933-54172955 ACGGGCACACAGGTGGAGAAAGG + Intronic
1096836671 12:54355649-54355671 AAGGGGAGATACAAGGAGAATGG - Intergenic
1096875241 12:54624893-54624915 AAGGAAGGACAGAAGGAGAAGGG - Intergenic
1097794268 12:63844903-63844925 GAAGGCACACAAAAGGAGCAAGG - Intronic
1098840470 12:75471530-75471552 AAGGGCAAAGAGAAGCAGCATGG + Intergenic
1100302322 12:93319299-93319321 AAGGTCACACAGAAAGAAAGAGG + Intergenic
1100588463 12:96001146-96001168 AAGGAGACAGAGGAGGAGAAAGG + Intronic
1101011276 12:100452556-100452578 AAGGGAAGAAAGATGGAGAATGG + Intergenic
1101044931 12:100794993-100795015 AAGAGTCAACAGAAGGAGAAGGG - Exonic
1101450455 12:104772820-104772842 AAGGGCAAAAAGAAGGGGAATGG - Intergenic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1101629444 12:106478766-106478788 AAGGTCAAACAGAACAAGAAAGG + Intronic
1102192268 12:110997707-110997729 AAGGGCAGCCTGAAGGTGAAAGG - Intergenic
1102224163 12:111216256-111216278 AAGGTCACACAGCAAGTGAATGG - Intronic
1102724552 12:115049413-115049435 ACTGACACACAGAAGGAGAAAGG + Intergenic
1103358785 12:120341838-120341860 AGGGACACACAGAAGGGGGATGG + Exonic
1104045762 12:125161548-125161570 AAGGGAAATCAGGAGGAGAATGG - Intergenic
1104310933 12:127653797-127653819 GAGGGCACAAAGATGGAGAAAGG + Intergenic
1105984359 13:25550645-25550667 AAGGAGAAACGGAAGGAGAATGG - Intronic
1106685867 13:32057998-32058020 CAGGCCACACAGAAGCAGAAAGG + Intronic
1107067838 13:36235063-36235085 AACAGCACAAAGAAGGTGAAGGG + Intronic
1107171204 13:37343781-37343803 GTGGGCACTGAGAAGGAGAAAGG + Intergenic
1107229569 13:38091831-38091853 AAGGGAAAACAGAGGAAGAAGGG + Intergenic
1107351988 13:39524496-39524518 AAAGGCTCACTGAAAGAGAAGGG + Intronic
1107792752 13:44018475-44018497 AAGGGCACACAGAGAGCTAAAGG + Intergenic
1108148094 13:47500976-47500998 AAGGGCAGACAGAATGAGAAGGG - Intergenic
1109753046 13:66721806-66721828 AAGGGCACAAAGAAAGATACAGG - Intronic
1110304627 13:73970895-73970917 AAGGGCTCAAAGCAGCAGAAGGG + Intronic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1112352775 13:98650417-98650439 AAGGGCACAGAGAGTGAGCAGGG + Intergenic
1113065555 13:106370775-106370797 AGAGGTACACAGAAGAAGAAAGG - Intergenic
1113109581 13:106807896-106807918 AAGGGCAGAGAGTAGGTGAAGGG - Intergenic
1113375194 13:109758936-109758958 AAGGGGAAAGGGAAGGAGAAGGG + Intronic
1113524043 13:110959909-110959931 ACGGGCACAGAGAGAGAGAATGG - Intergenic
1113627028 13:111855018-111855040 GAGGGCACCCAGATGGAGAGGGG + Intergenic
1113819490 13:113203131-113203153 ACTGGCACAGAGCAGGAGAAGGG + Intronic
1113855151 13:113439787-113439809 AAGGTCACTCAAGAGGAGAAAGG - Intronic
1115211749 14:30973351-30973373 AAGGGGACAGAGAGGGAGAGGGG + Intronic
1116752881 14:48909095-48909117 AGGGGAAGAAAGAAGGAGAAAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117224659 14:53642713-53642735 AAGGCCACACAGCAGGAGGTGGG - Intergenic
1117815128 14:59589864-59589886 AAGCACACACACAAAGAGAAAGG + Intergenic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1119129567 14:72158895-72158917 AATGCCACACAGAAAGAAAAGGG - Intronic
1120592599 14:86393371-86393393 AATGGCCCAAAGAATGAGAAAGG - Intergenic
1120617013 14:86719390-86719412 AAGAACACACAATAGGAGAATGG - Intergenic
1120878907 14:89399322-89399344 AAGAGCACACAGAGGGAGCTGGG + Intronic
1121423274 14:93830827-93830849 AAGGCCACACAGCAGGTCAATGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121933768 14:97997534-97997556 GAGGAAACACAGCAGGAGAAAGG - Intergenic
1122392789 14:101401803-101401825 AAGAGGAAAGAGAAGGAGAAGGG - Intergenic
1122667130 14:103338377-103338399 AAGGGCAAAGACAAGGAAAATGG + Exonic
1122895651 14:104755517-104755539 GAGGGCACACAGGAGGACGATGG + Intronic
1123736377 15:23188189-23188211 AAGGGGAAAGCGAAGGAGAAAGG - Intergenic
1124287083 15:28411166-28411188 AAGGGGAAAGCGAAGGAGAAAGG - Intergenic
1124295618 15:28500463-28500485 AAGGGGAAAGCGAAGGAGAAAGG + Intergenic
1125089764 15:35776608-35776630 AAGGCCCAAAAGAAGGAGAATGG + Intergenic
1125213374 15:37240725-37240747 AAGGGCAGAGATACGGAGAAGGG + Intergenic
1125517710 15:40332001-40332023 GAGGGCACACAGGAGGAGGGAGG - Intronic
1125680844 15:41529375-41529397 CAGGGCACACAGAAGGTCAAAGG + Intronic
1125730005 15:41887798-41887820 AAGTGGACACAGATGTAGAAAGG - Intronic
1126386567 15:48099579-48099601 ATGGGTAGGCAGAAGGAGAAGGG - Intergenic
1126896938 15:53268125-53268147 GAGGTCACACAGGAGTAGAATGG - Intergenic
1127350310 15:58145176-58145198 AAGGGCACACAGAGGAGAAAAGG - Intronic
1127640545 15:60912028-60912050 AAGGTCACAGAGGTGGAGAAAGG + Intronic
1128075783 15:64824501-64824523 GAGGTCACAAAGACGGAGAAAGG + Intronic
1128867417 15:71125107-71125129 AAGGGGAAAGGGAAGGAGAAAGG + Intronic
1129905268 15:79182807-79182829 AAGGGAAGAAAGAAAGAGAAAGG - Intergenic
1130064471 15:80592722-80592744 AAGGCCTTACAGAAGGAGGAAGG - Intronic
1130096603 15:80860860-80860882 GAGGGAACACAGAAAGAGAAGGG - Intronic
1130885426 15:88088843-88088865 AGGGTCACACAGCTGGAGAACGG - Intronic
1131038219 15:89239649-89239671 AAGGGAACACAGAAGCATCAGGG - Intergenic
1131201010 15:90395946-90395968 ACGGGCACTCAGCAGCAGAAAGG - Intronic
1131525051 15:93146108-93146130 AAGGTCACACACAGGGAGAGAGG - Intergenic
1131604150 15:93882854-93882876 AAGAGGACACAGAAGGTAAAAGG + Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1132087618 15:98921189-98921211 AGGAGCACCCAGATGGAGAAAGG - Intronic
1132267883 15:100492973-100492995 AAGAGCACAAAGAAGGGGACGGG - Intronic
1132539888 16:503891-503913 AAGGGGTCACAGAAGGTGAGGGG - Intronic
1132847448 16:2007036-2007058 ATGGGCACACAAAAGGACAGCGG + Intronic
1132986817 16:2771616-2771638 GGGGGCACTTAGAAGGAGAAAGG + Intronic
1133562040 16:6959514-6959536 AAATGCACACAGAATGAGAGAGG - Intronic
1133981983 16:10639846-10639868 GAGGGGACACAGAAGGGGACAGG - Intronic
1134359430 16:13517620-13517642 AACGGGACATATAAGGAGAAGGG - Intergenic
1134368660 16:13603307-13603329 CAGAGCTCCCAGAAGGAGAAAGG - Intergenic
1134673986 16:16076479-16076501 AAGGTCACAGAGAGGGAGCACGG - Intronic
1134718963 16:16370596-16370618 AAGGGGAGAGAGATGGAGAAAGG - Intergenic
1135186057 16:20316902-20316924 AAGGGAAGAGAGAGGGAGAAAGG - Intronic
1135263908 16:21005206-21005228 AAGGAAATACAGAAGGAGAGAGG - Intronic
1135795971 16:25442858-25442880 AAGGGAAAGGAGAAGGAGAAGGG - Intergenic
1135795975 16:25442876-25442898 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1135892230 16:26367548-26367570 AAAGGCACAGAGATGGGGAATGG + Intergenic
1136299026 16:29320901-29320923 AAGGACACATCCAAGGAGAAGGG - Intergenic
1136345980 16:29676328-29676350 TAGGGTACCCAGAAGGAAAAGGG + Intronic
1136397532 16:30001329-30001351 AAATGCAAACAGAAGGAGGATGG - Intronic
1136537233 16:30907165-30907187 AAGGACACACCGAGAGAGAAGGG - Intergenic
1137306745 16:47208042-47208064 AAGGTAACACAGCAGGAGACTGG + Intronic
1137779633 16:51087104-51087126 AAGGGCAGGCAGACAGAGAAAGG - Intergenic
1138035143 16:53596740-53596762 AGGTGCCCACAGAAGGAGAAGGG - Intergenic
1138089842 16:54165139-54165161 AAGGACACACAGGAGGTGGAGGG - Intergenic
1138277436 16:55746035-55746057 GAGGGCAGGCAGAAGGAGAGAGG + Intergenic
1138543721 16:57704215-57704237 AAAGTCACACAGCAGGAAAATGG + Intronic
1138623485 16:58230644-58230666 ACGGGCACAGGGGAGGAGAAGGG + Intergenic
1138652626 16:58469898-58469920 AAGAGCACACAGATGGTGAGTGG + Intronic
1139018128 16:62714847-62714869 AAGGAGAAAAAGAAGGAGAAGGG - Intergenic
1140055925 16:71525713-71525735 AAGGGCACACAGCAAGGGAGAGG + Intronic
1140894502 16:79313314-79313336 AACGGCACACAGGAGCACAAGGG + Intergenic
1141195118 16:81854607-81854629 TAAGGCACAGGGAAGGAGAAAGG - Intronic
1141263070 16:82471327-82471349 AAGGAGAAACAGAAGGGGAAGGG - Intergenic
1142121564 16:88389041-88389063 AAGCGCACACTGTAGGAGAGCGG - Intergenic
1142338444 16:89505699-89505721 AAGAACACACAGGCGGAGAAGGG + Intronic
1142644027 17:1300663-1300685 CAGAGCACAGAGCAGGAGAAGGG + Exonic
1142688042 17:1589055-1589077 AACGGGTCACAGAAGGAGGAGGG + Intronic
1143116327 17:4583867-4583889 AAGGGCAGACAGAGAAAGAAGGG - Intergenic
1143666670 17:8366168-8366190 ATGGGCACGGGGAAGGAGAAAGG - Intergenic
1143967646 17:10768236-10768258 AAAGGCACACAGCAGCAGAAGGG + Intergenic
1144816963 17:18041079-18041101 AAGGGCAAAGGGAAGGGGAAAGG - Intronic
1144848151 17:18230712-18230734 AAGGCCACACAGGAGGGGTAGGG - Intronic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1145302100 17:21648017-21648039 GTGGGCCCACAGAAGGGGAAGGG - Intergenic
1145328446 17:21850801-21850823 GTGGGCCCACAGAAGGGGAAAGG - Intergenic
1145348210 17:22055299-22055321 GTGGGCCCACAGAAGGGGAAGGG + Intergenic
1145415370 17:22710085-22710107 GTGGGCCCACAGAAGGGGAATGG - Intergenic
1145828508 17:27895980-27896002 AAGGGAACACAAGAGGAAAAAGG + Intergenic
1146252607 17:31362532-31362554 AAGGAAATAAAGAAGGAGAAGGG - Intronic
1146320984 17:31846197-31846219 GAGGGCACACGGAGAGAGAAGGG - Intergenic
1146608028 17:34278771-34278793 AAGGGCAGCCAGAGAGAGAAAGG + Intergenic
1146621613 17:34402768-34402790 AAGGCCACACAGTTGCAGAAAGG + Intergenic
1146633061 17:34484499-34484521 AAGGGCACACAGCTGGTGAGTGG - Intergenic
1146676334 17:34776041-34776063 AAGGGCACAGAGGTTGAGAATGG - Intergenic
1146951865 17:36912556-36912578 AAGGCCACACAGATGAAGGAGGG - Intergenic
1147663481 17:42130072-42130094 AAGGCCACACAGATCAAGAAGGG + Intronic
1147890048 17:43710781-43710803 AAGGGCAAAGAGAGGGAGAAAGG + Intergenic
1147915885 17:43885586-43885608 AAGTTCTCACTGAAGGAGAAGGG - Intronic
1148063267 17:44851015-44851037 TTGGGCTCACAGAAAGAGAAGGG - Exonic
1148354592 17:46967515-46967537 AAGGGCGAAGAGAAGGAGAGAGG + Intronic
1148476134 17:47929885-47929907 AAGGGAACAGAGCAGGGGAATGG - Intergenic
1148606127 17:48930442-48930464 AAGGGCACACAGCAGCAGGCAGG - Exonic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1148863309 17:50615721-50615743 AAGGTCACACAGAAAGGGAGTGG + Intronic
1150158898 17:62877312-62877334 AAGGGCACACAGCTAGAAAATGG - Intergenic
1150220846 17:63495221-63495243 CGGGGCACACAGAAGGAGAGGGG - Intronic
1150853877 17:68732136-68732158 AAGGGCACAGTGAAGGACAGAGG + Intergenic
1151193737 17:72416919-72416941 AAGTGGACCTAGAAGGAGAAAGG - Intergenic
1151510679 17:74557519-74557541 ATGGGCACTAACAAGGAGAAAGG - Intergenic
1151596765 17:75082697-75082719 AAATGGACACAGAAGGAGACAGG - Intergenic
1152022468 17:77787737-77787759 AAGGGCACACAGAAGAGAGAGGG + Intergenic
1152188724 17:78875300-78875322 AAGGACAAACAGAAGGAAAGAGG + Intronic
1152975956 18:218492-218514 AAGGGCAAACAGAAGAACCATGG + Intronic
1153663710 18:7349520-7349542 GAGGCCACCCACAAGGAGAAAGG - Intergenic
1153950982 18:10057487-10057509 TAGGGGACAGGGAAGGAGAATGG + Intergenic
1154325914 18:13390304-13390326 AAGGACACATAGCAGGAGCACGG - Intronic
1155060796 18:22226768-22226790 AAAGGCACTGAGAAGGAGAGTGG - Intergenic
1155197029 18:23485151-23485173 AAGTGCACACAAAAGGGAAAGGG + Intronic
1156032449 18:32728311-32728333 AAGGTCACACAGATGGTAAATGG - Intronic
1156354843 18:36332061-36332083 AAGGGAACACTGCAGGAGGAAGG - Intronic
1157436232 18:47671802-47671824 GAGGGCACTCAGAATGAGGATGG + Intergenic
1157543967 18:48534911-48534933 AACGTCACACAGCAGGAGAGGGG + Intergenic
1158249793 18:55475020-55475042 AAGTGCACACAGAAGTACTAAGG - Intronic
1158280542 18:55820798-55820820 AGACACACACAGAAGGAGAATGG + Intergenic
1159722129 18:71904374-71904396 AAAGGCAGAGAGAAAGAGAAAGG + Intergenic
1159959064 18:74541485-74541507 GAGGAGTCACAGAAGGAGAAGGG + Intronic
1160003226 18:75047546-75047568 AACTGCACACAGAAAGTGAAGGG - Intronic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160187581 18:76687594-76687616 ACAGGCACACAGAAGGGGCAGGG + Intergenic
1160523068 18:79520030-79520052 GAGGGCACACACCAGGAGAGGGG + Intronic
1161582955 19:5090748-5090770 AAGGTCACACAGCAGGAGGCTGG + Intronic
1161606710 19:5219140-5219162 AAGGTCACACAGCATGGGAATGG - Intronic
1161656120 19:5516125-5516147 AGGGGGACAGAGGAGGAGAACGG - Intergenic
1161970658 19:7578044-7578066 AAGAGGACACCGAAGGAGGAAGG + Intergenic
1162322914 19:9980290-9980312 AAGGTCACACAGTAGGTGAGTGG + Intronic
1162942851 19:14024045-14024067 AAGGTCACACAGCAGGAAAGAGG + Intergenic
1163003786 19:14384719-14384741 AAGGGGAAACAGGAGGAGATGGG - Intronic
1163161469 19:15467144-15467166 GAGGTCACACAGAGGGAGAGGGG - Intergenic
1163532414 19:17858191-17858213 AACGGCACAAAGGAGGTGAAGGG + Intergenic
1163669811 19:18620835-18620857 GAGGGGACATAGAAGGAAAAAGG - Exonic
1163926760 19:20353257-20353279 AAGAGCACACAGAGGGGGGAGGG - Intergenic
1166347537 19:42175936-42175958 GAGGGCACAGGGAACGAGAAAGG - Intronic
1168251571 19:55145308-55145330 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1168485129 19:56755006-56755028 AAGGGGAAAATGAAGGAGAAAGG + Intergenic
1168614397 19:57826247-57826269 AAACACACACACAAGGAGAAGGG + Intronic
924978270 2:197447-197469 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978281 2:197499-197521 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978298 2:197603-197625 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978309 2:197655-197677 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978320 2:197707-197729 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978331 2:197759-197781 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978352 2:197863-197885 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978363 2:197915-197937 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978374 2:197967-197989 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978385 2:198019-198041 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978396 2:198071-198093 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978427 2:198227-198249 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978438 2:198279-198301 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978449 2:198331-198353 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978460 2:198383-198405 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978471 2:198435-198457 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978482 2:198487-198509 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
925575152 2:5352502-5352524 CAAGGAACCCAGAAGGAGAAAGG + Intergenic
925842624 2:8006742-8006764 GATGGCACAGGGAAGGAGAAAGG - Intergenic
925953384 2:8937155-8937177 AGGGGCACAGAAAAGGAGACAGG + Intronic
925991145 2:9255553-9255575 AAGGACACACAGAACCAGAGAGG - Intronic
926550271 2:14293208-14293230 AAGGGCATGTAGAAGGATAATGG + Intergenic
926553218 2:14325615-14325637 AAGGGAGGAAAGAAGGAGAAGGG + Intergenic
927413871 2:22856339-22856361 TAGGCCACACAGGAGGAGGAAGG + Intergenic
928694124 2:33831809-33831831 AAGGGAAGACAAAAGGAGCAGGG + Intergenic
928771210 2:34703316-34703338 AAGGGAACATTGAAGGGGAAAGG + Intergenic
929318776 2:40514360-40514382 GTGGGCAAACAGAAGGACAAAGG + Intronic
929362151 2:41104531-41104553 AAGGGAAGGAAGAAGGAGAAGGG + Intergenic
929542895 2:42835989-42836011 GATGACACACAGAGGGAGAAAGG - Intergenic
929667262 2:43842690-43842712 AAGGGGACACAGTAGGAGTGCGG - Intronic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
930302206 2:49630628-49630650 AAGGGCAGAGAGAAGGGGAAGGG + Intergenic
930485223 2:52003005-52003027 AAGAGCACCCACAAGGAAAAAGG - Intergenic
932075347 2:68657133-68657155 AAGGTACCACAGAAGGACAAAGG - Intergenic
932123345 2:69121123-69121145 ATGAGCACACAAAAGGAGGAGGG - Intronic
932486804 2:72089131-72089153 AAGGGAACAAGGAAGAAGAAAGG + Intergenic
932525952 2:72468409-72468431 AAGAACACACAAAAGGGGAAAGG - Intronic
932842413 2:75095814-75095836 AAGGGCACACAGAAGGGACAGGG - Intronic
933200663 2:79444550-79444572 AAAGGCAGACAGAAGCAGCAAGG - Intronic
933436313 2:82255011-82255033 AAGGGCATACATAATGATAAAGG - Intergenic
934573782 2:95388041-95388063 AAGGTCACACAGCTGGTGAATGG - Intergenic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934776370 2:96940220-96940242 AAGGGCACCCGGCATGAGAACGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
935265754 2:101392453-101392475 AATGACACACAGAAGGAGGAAGG + Intergenic
936263604 2:110982430-110982452 AAGGGATGACAGAAGAAGAAGGG - Intronic
936475274 2:112834087-112834109 AAGGGCACACAGCAGGTTAGAGG + Intronic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
939332507 2:140782921-140782943 AAGGTCACACAGCAGGAGTATGG + Intronic
939710627 2:145514232-145514254 AGGAGCACAAAGGAGGAGAAGGG + Intergenic
939822649 2:146976658-146976680 AGGGGGACACTGGAGGAGAAAGG - Intergenic
940439136 2:153693632-153693654 AAGGGCAAGCAGGAGGATAAGGG + Intergenic
940609837 2:155976295-155976317 AAGGCCAAAAATAAGGAGAAGGG + Intergenic
940733879 2:157427131-157427153 ATAGACACACAGAAGGAGGAAGG + Intronic
941497613 2:166225764-166225786 AAAGACACACAGAGGGAAAATGG + Intronic
942335598 2:174881560-174881582 AAGCTAACAGAGAAGGAGAAAGG - Intronic
942473411 2:176287122-176287144 AAAGGTACACATAAGGAGATAGG + Intronic
942813782 2:180027406-180027428 AGAGGCACACAGAGAGAGAAGGG - Intergenic
943465394 2:188222901-188222923 AAAGACACACAGAAGGAAGATGG - Intergenic
943668451 2:190635071-190635093 AAGGGATCACAGAACAAGAAAGG - Intergenic
943794321 2:191972535-191972557 AAGGGGACACAGAGGAAGCAGGG + Intronic
946482887 2:220073811-220073833 AAGGGGAGGCAGAAGGAAAATGG + Intergenic
946667798 2:222068879-222068901 AAAGGCACAAGGAATGAGAAGGG - Intergenic
946707795 2:222475831-222475853 AAGGGCACACAGATGGGGCCTGG - Intronic
947395239 2:229680227-229680249 AAGGTGACGCAGAAGGAGTATGG + Intronic
947614791 2:231548881-231548903 AGGGGCACAAGAAAGGAGAAGGG - Intergenic
947833897 2:233161691-233161713 AAGGGCAGACAGACTTAGAAAGG - Intronic
947945815 2:234101364-234101386 ACAGGCAGACAGAAAGAGAAAGG + Intergenic
948790527 2:240374339-240374361 AAGGGACCAGAGAAGGAGGATGG + Intergenic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
948834084 2:240616185-240616207 AGAGGCAAACAGAAGGAAAAAGG - Intronic
1168805670 20:671026-671048 AAGGCCACACAGAAGGCTAATGG + Intronic
1168916081 20:1489557-1489579 AAGGGGACTCAGAAGGGGAGAGG - Intronic
1169736556 20:8844213-8844235 AACGGCAAACAAAAGGACAACGG - Intronic
1170415726 20:16138021-16138043 AAAGGCACAGACAGGGAGAATGG + Intergenic
1170538093 20:17361798-17361820 AAGGGCTCTCACAAGAAGAAAGG + Intronic
1170542164 20:17400373-17400395 AAGGTCACACAGATGATGAAGGG - Intronic
1170872066 20:20214877-20214899 CAGGGCAGGCAGAAGGAGAGTGG + Intronic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1170930175 20:20762549-20762571 GAGGGCACAGAGCAAGAGAAGGG - Intergenic
1171048836 20:21836956-21836978 AAGGTCACACAGCAGAAAAAAGG - Intergenic
1171558166 20:26096764-26096786 GTGGGCCCACAGAAGGGGAAGGG + Intergenic
1172038498 20:32027295-32027317 AAGGGCATACAGTATGAGGAAGG - Intronic
1172221285 20:33276749-33276771 AAGGAGAGACAGAAAGAGAAGGG + Intronic
1172591359 20:36120354-36120376 TAGAGCACACAGGAGGAAAAGGG + Intronic
1172636649 20:36414562-36414584 AAGGTCACACAGCAGGTGGAGGG - Intronic
1173411023 20:42809405-42809427 AAGGGCACTGAGATGGAGCAGGG + Intronic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1174126453 20:48310487-48310509 AAGGTCGCACAGCTGGAGAACGG - Intergenic
1174345256 20:49924347-49924369 AAGGTCACACAGATGGAAAGCGG - Intergenic
1174511469 20:51056670-51056692 TAAGGCACACACAAGGAGAGGGG - Intergenic
1174596448 20:51688041-51688063 GAGGTCACACAGCAGGTGAAAGG - Intronic
1174859583 20:54077950-54077972 AGGGGCTGACAGAAGGGGAATGG + Intergenic
1175159077 20:56994637-56994659 AAGGTCACACAGCTGGAAAAAGG - Intergenic
1175661714 20:60819163-60819185 AAAGGCACACAGAATTAAAATGG - Intergenic
1175750820 20:61495943-61495965 AGGGACACACAGCAGGAGAGAGG + Intronic
1176065875 20:63194458-63194480 AAGGAAACACAAAATGAGAACGG - Intergenic
1176412639 21:6457376-6457398 GAGGGCACACAGAGGGTGAGAGG + Intergenic
1176652833 21:9565850-9565872 GTGGGCCCACAGAAGGGGAAGGG - Intergenic
1177421672 21:20867348-20867370 AGGGGGACAGAGAGGGAGAAAGG - Intergenic
1178114340 21:29401911-29401933 AAGGTCACACTGAAGTAGAGTGG + Intronic
1178162620 21:29937571-29937593 AAAGGAACTCAGGAGGAGAAGGG - Intronic
1178598817 21:33978286-33978308 AGGGGCACAGAGAACGAGGAGGG + Intergenic
1179249801 21:39663389-39663411 AAGAACACACAGAAGCAGTAGGG - Exonic
1179688133 21:43065698-43065720 GAGGGCACACAGAGGGTGAGAGG + Intronic
1181494547 22:23280645-23280667 ATCGTCACAGAGAAGGAGAAGGG + Intronic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1181790719 22:25263733-25263755 AAAGGCAGACTGGAGGAGAAGGG + Intergenic
1182550927 22:31100398-31100420 AAGGGAAGACAGATGGAGAAGGG - Intronic
1182878338 22:33711611-33711633 AAGAGCACAGAGAAGGGAAAAGG + Intronic
1182886407 22:33777666-33777688 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1183226748 22:36555613-36555635 AAGGGCAAGGAGAAGGAAAAGGG - Intergenic
1183292571 22:37011903-37011925 AAGGCCACACAGAAAGATGAAGG + Intronic
1183422358 22:37719258-37719280 GAGGGGACAGAGAAGGAGAGAGG + Intronic
1183519875 22:38290658-38290680 AAGGGCACAGAGGTGGACAAAGG + Intergenic
1183748212 22:39704351-39704373 AAGGGCACAAAGGTGGAGGAGGG + Intergenic
1184209923 22:43029385-43029407 GAGGGCACTCAGAGGCAGAAAGG + Intergenic
1184991297 22:48171690-48171712 AGGGCCACACAGAAGCAAAAGGG - Intergenic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
949130330 3:492394-492416 AGGGGCAAACTGAAGGAAAATGG + Intergenic
949483648 3:4517251-4517273 AAAGGCAGACAGAGGCAGAATGG + Intronic
949508058 3:4745053-4745075 AAGAAAACACAGAAAGAGAAAGG - Intronic
950802107 3:15561167-15561189 AAGTACACTCAGAAGGAGAAGGG + Intronic
951795921 3:26538222-26538244 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
953145108 3:40267739-40267761 AAGGGCAGATAGAAGGACAGAGG + Intergenic
953239745 3:41138126-41138148 AAGGACACACAGTTGGGGAATGG + Intergenic
953768899 3:45763886-45763908 ACGGGGACACACAAGGAGAAAGG + Intronic
953860648 3:46541506-46541528 AAGGGCAAAGAGAAAGGGAAAGG + Intronic
953990046 3:47476717-47476739 AGGGCCTCACAGAAGGGGAAGGG + Intronic
954142910 3:48619569-48619591 AAGGGGAAAAAGAAAGAGAAAGG + Intergenic
955399422 3:58581066-58581088 AAAGCCACACAGAAGGAGGCAGG - Intronic
955401384 3:58594075-58594097 AAGAGCATAGAGAAGGTGAAAGG - Intronic
955403722 3:58611704-58611726 AAGGCCACACAGCAGGTCAATGG - Intronic
955842376 3:63125872-63125894 AAGGTCACACAGAAGCAAAGTGG - Intergenic
956289690 3:67648402-67648424 AAGGGCAAAAAGATGGGGAAAGG + Intronic
956856129 3:73276573-73276595 AAGGTCACACAGCTGGAAAACGG + Intergenic
956923987 3:73962614-73962636 AAGGGCATATAGAAGGAAAGAGG + Intergenic
957134890 3:76273962-76273984 AAGGGCAAAGAGAGGGTGAAAGG + Intronic
957416910 3:79917361-79917383 AAGGGAAGAAAGAAGGAAAAAGG + Intergenic
957793347 3:84967891-84967913 AATGGCAAAAAGAAGGGGAAAGG + Intronic
957884246 3:86263529-86263551 AAGGAAACACAAAAGTAGAATGG - Intergenic
958476208 3:94586321-94586343 AAGGGTACACTGGAGGAGAATGG - Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
959840369 3:110968023-110968045 AAGAGAACACAAAAGGAAAATGG - Intergenic
960026978 3:113020660-113020682 AAAGGCGCACAGAAAGAGCATGG - Intergenic
960396062 3:117138893-117138915 AAGAGTACTCAGAAGTAGAAAGG + Intronic
960525791 3:118708382-118708404 TAGGGCACACAGTAGTTGAAGGG - Intergenic
960557661 3:119046729-119046751 AAGGGCAGCCAGAGAGAGAAAGG + Intronic
960869040 3:122230831-122230853 GAGGGGACAGAGAAGTAGAAGGG - Intronic
960913505 3:122673893-122673915 AAGGCCACACAGCTAGAGAATGG - Intergenic
961236462 3:125372421-125372443 AAGGTCAGAAAGGAGGAGAAAGG + Intronic
961328873 3:126127419-126127441 AGGGCCGCACAGCAGGAGAATGG - Intronic
961546649 3:127639013-127639035 AAGGGGAGACAGATGGAGACAGG - Intronic
961586493 3:127931810-127931832 AAAAGAACAAAGAAGGAGAATGG + Intronic
961591481 3:127984910-127984932 AAGGGGATTCTGAAGGAGAATGG - Exonic
962195583 3:133360395-133360417 AAGGGAACAATGAAGGAGTAAGG + Intronic
962351657 3:134660832-134660854 GAGGCCATACAGAAGGAAAATGG - Intronic
962353508 3:134673617-134673639 CAGGGTACACAAAAGGACAAAGG - Intronic
962604648 3:137023458-137023480 AAGGGCTCCCAGAGGGAGCATGG + Intergenic
962842035 3:139242698-139242720 AAGGACACACAAATGGACAATGG - Intronic
962967130 3:140365622-140365644 AAGGCCACACAGATGGTAAATGG + Intronic
963225214 3:142855481-142855503 AAGGCCACCCAGAAAGACAATGG + Intronic
964389771 3:156185044-156185066 AAGGCCACACAGAAAGAAAGTGG + Intronic
964766163 3:160179824-160179846 AAGGGCAGAAAGAGGGAGAGGGG + Intergenic
965802754 3:172511527-172511549 GAGAACACAGAGAAGGAGAATGG + Intronic
966238745 3:177731128-177731150 AAGGCCACACAGATGGTGAGTGG + Intergenic
966321604 3:178707078-178707100 AAGTGGAGACAGAAGGAGAAAGG + Intronic
966591389 3:181687271-181687293 AAAGGCACAAAGAAGTACAATGG + Intergenic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
967279307 3:187806658-187806680 CAGGACACACAGAATGAGAGTGG - Intergenic
967501043 3:190197735-190197757 AAGGGGAGAAAGAAGGGGAAAGG + Intergenic
967936125 3:194729139-194729161 AAGGGCACACAGTAAGTGAATGG + Intergenic
968963738 4:3759001-3759023 AAGGACCCACAGATGGAGACAGG + Intergenic
969928081 4:10603958-10603980 AGGAGCAGAAAGAAGGAGAAAGG + Intronic
969979526 4:11140470-11140492 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
970215152 4:13751167-13751189 CAGATCACAAAGAAGGAGAAGGG + Intergenic
970573358 4:17404285-17404307 AAGGGAAGGAAGAAGGAGAAAGG + Intergenic
972009983 4:34166898-34166920 AAGGGAATAATGAAGGAGAACGG + Intergenic
972169207 4:36324245-36324267 GAGGGGCCAGAGAAGGAGAAAGG - Intronic
972418225 4:38863304-38863326 AAGAGGACCCAGAAGGAGACTGG - Intergenic
973203067 4:47527186-47527208 AAAGACACATAGATGGAGAAAGG + Intronic
973288849 4:48449465-48449487 AGGGACATATAGAAGGAGAAAGG + Intergenic
973741709 4:53925173-53925195 AAGGCCACACAGCAAGTGAAGGG - Intronic
973783788 4:54316331-54316353 AAAAGCAGACAGAAGGAAAATGG - Intergenic
973843003 4:54881453-54881475 AAGGGCACAGACATGGATAAGGG + Intergenic
973886818 4:55330685-55330707 AAGGGGACAATGAAGGGGAAGGG - Intergenic
974524952 4:63038832-63038854 AAGAGCAGACAGGAGGGGAAGGG + Intergenic
975299017 4:72767505-72767527 AAGGTCACACAGATGGAAAGTGG - Intergenic
975930187 4:79512121-79512143 AAGGACACAGTGAAAGAGAAAGG + Intergenic
975987365 4:80213796-80213818 AAGGTTACACAGCTGGAGAATGG - Intergenic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
978549516 4:109910370-109910392 AAGGACATAGAGAAGGAGAAGGG - Intergenic
979085433 4:116404287-116404309 TAGGGAATACAGAAGGAGAGAGG + Intergenic
980666674 4:135948379-135948401 AAGAGCACAGAGAAGAACAACGG - Intergenic
981041393 4:140225849-140225871 AAGGCCACAGACATGGAGAATGG + Intergenic
981491915 4:145348679-145348701 CAGAGCCCACAGAAGGAGAATGG - Intergenic
981639604 4:146925542-146925564 ATGGCCACACAGAAGTACAAAGG - Intronic
981898549 4:149834488-149834510 AAGGTCACACAGATAGACAAGGG - Intergenic
982326995 4:154138047-154138069 AGGAGCACAAAGAGGGAGAAGGG + Intergenic
982998173 4:162378397-162378419 ACGGGCAGACAGAAAGAGAGAGG + Intergenic
984376271 4:178934675-178934697 AAGGGAAATGAGAAGGAGAAAGG - Intergenic
985107317 4:186511623-186511645 CAGGGCACACTGAAGGGCAACGG - Intronic
985364227 4:189210133-189210155 AAGGTCACACAGAAAGTGAGAGG - Intergenic
985385579 4:189444174-189444196 AAGGAGAAAGAGAAGGAGAAAGG - Intergenic
986694206 5:10337841-10337863 ATGGGCAGAGAGAAAGAGAAGGG + Intergenic
986700613 5:10404668-10404690 AAGGGAACACAAAAGCACAAAGG + Intronic
987152180 5:15054399-15054421 AAGGACACACACAAAGTGAAGGG - Intergenic
987159771 5:15130216-15130238 AAGGGCACCCAGATGCATAAAGG - Intergenic
988061482 5:26175798-26175820 AAGGCCCTACAGAAGGAAAATGG + Intergenic
988378548 5:30471971-30471993 AATGGCACATAGAAGAAAAATGG - Intergenic
988729330 5:33954732-33954754 AAGGGCAAAGGGAATGAGAATGG + Intronic
988786890 5:34573287-34573309 AAGGGCAAAGAGAAGGCGAGAGG - Intergenic
989735733 5:44702561-44702583 AAGGGCATACTGTAGGAGTAAGG + Intergenic
990007860 5:50964073-50964095 AAGGCCCCACAGGAGGAGGAGGG + Intergenic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990468226 5:56089127-56089149 CTGGGAACACAGGAGGAGAAAGG - Intergenic
991960202 5:72036768-72036790 AAGGAAACAGAGCAGGAGAATGG + Intergenic
993284321 5:85971454-85971476 AAAGGCACACAGAAGGCCATTGG - Intergenic
994094811 5:95839134-95839156 AGGGGGACCCAGGAGGAGAAGGG + Intergenic
994412820 5:99431039-99431061 AAGGGAAATCAGCAGGAGAACGG - Intergenic
994481021 5:100334681-100334703 AAGGGAAATCAGCAGGAGAACGG + Intergenic
994782925 5:104116177-104116199 AAGGGGAAACAAAAGGAAAATGG + Intergenic
994936598 5:106260772-106260794 AAGAGGAGACAGAAGAAGAAAGG - Intergenic
995412371 5:111873251-111873273 AAGGACACAGAGAAGAAGAACGG + Intronic
996457111 5:123697189-123697211 ATGGGCAAAGAGAAAGAGAATGG + Intergenic
996646713 5:125826395-125826417 AAGTGGATCCAGAAGGAGAATGG - Intergenic
997265353 5:132491675-132491697 TAGGGAACAGAGGAGGAGAAGGG + Intergenic
997342076 5:133152766-133152788 AAGGACACCAAGAAGGAGAGGGG - Intergenic
997382613 5:133448521-133448543 GAGGGCACACAGAAGTTAAAGGG + Intronic
997520469 5:134520767-134520789 AAGTGAACATAGAAAGAGAAGGG - Intergenic
998155404 5:139783923-139783945 AAGAGCTAGCAGAAGGAGAAAGG - Intergenic
998245428 5:140498304-140498326 AAAGGCTCACAAAAGAAGAAAGG - Intronic
998251921 5:140559125-140559147 AAGGTCACACAGCCAGAGAAAGG + Intronic
998614828 5:143728397-143728419 AAGGGCCAACAGAAAGAGAAAGG - Intergenic
999500166 5:152138950-152138972 AAAGGCACAGAGATGGGGAAGGG + Intergenic
999730844 5:154475917-154475939 AAGGACACACAGAAGAAAAGAGG + Intronic
999817672 5:155193642-155193664 AAGGTCACACAGCACGAAAATGG + Intergenic
1000160019 5:158588073-158588095 AAGGTCACACAGTCAGAGAAAGG + Intergenic
1000201999 5:159020295-159020317 AAAGGCACATAGATTGAGAATGG + Intronic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000472495 5:161662488-161662510 TAGGCCACACATAAGGAGAAGGG - Intronic
1000805831 5:165790522-165790544 GAGGACACACAAAAGTAGAAGGG - Intergenic
1001157206 5:169283088-169283110 AAGGGCACCCAGCTGGTGAATGG + Intronic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1003094794 6:3133613-3133635 AAGGGCCCACACAAGGAGGCAGG - Intronic
1003331308 6:5130823-5130845 AAGGGCACAGAAAAGTAGAATGG + Intronic
1004180556 6:13377484-13377506 CAGGGCACACAGCAGGAAAGTGG - Intronic
1004332098 6:14731193-14731215 AAGGGAATACAGAGGGAGACAGG - Intergenic
1004429512 6:15531085-15531107 ACGTGCACACATAGGGAGAAGGG + Intronic
1004617408 6:17303605-17303627 AAGGGAAAAGGGAAGGAGAAGGG + Intergenic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005431402 6:25761647-25761669 ATGGGAACACAGAACTAGAAAGG + Intronic
1005802410 6:29440493-29440515 AAGGGCAAAGAGAAGATGAAAGG - Exonic
1006371924 6:33650146-33650168 AAGGGCAGAGAGAAGGAGGGTGG - Intronic
1006385564 6:33728887-33728909 AAGGGCAGACAGACGGGGGAGGG - Intronic
1006435419 6:34023563-34023585 AGGGGCACCAAGAAGTAGAAAGG - Intronic
1006972517 6:38061291-38061313 AAGGGTAATCAGAAGGAAAAAGG - Intronic
1007073451 6:39052450-39052472 AAGGCCTCTCAGAAGGAGGAAGG - Intronic
1007663900 6:43503244-43503266 ACGGACAGACAGAAGGAGACTGG - Intronic
1007924920 6:45643025-45643047 GAGGGCAGAGAGAAGGGGAAAGG - Intronic
1008025403 6:46630256-46630278 AATGGCACACAGAAGGAGAATGG + Intronic
1008111251 6:47497368-47497390 AAGGCGACAGGGAAGGAGAAGGG - Intronic
1008132673 6:47736807-47736829 AAGGGCACACAGCAGGGAAATGG - Intergenic
1008441962 6:51541982-51542004 TACGGCAGACACAAGGAGAATGG - Intergenic
1009318387 6:62253615-62253637 ACTGACACACAGAAGAAGAAGGG + Intronic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1010290708 6:74133312-74133334 GAGGGCACACAGTAGGAGGTGGG + Intergenic
1011597016 6:89025814-89025836 AAAGGAAAACTGAAGGAGAAGGG - Intergenic
1011598483 6:89038549-89038571 AAGGGCACACCTAAGGATAGTGG - Intergenic
1011733260 6:90287964-90287986 AAGTGAGCACAGAAGGAGGATGG + Intronic
1011863938 6:91796825-91796847 AAGTGCACAGAGAAGGATAATGG - Intergenic
1012375714 6:98559621-98559643 AAGGGAACACAGCACCAGAAAGG + Intergenic
1012781178 6:103559479-103559501 TTGGACACACAGTAGGAGAAGGG - Intergenic
1013421271 6:109969434-109969456 AATGTCAAACAGAAGGGGAATGG + Intergenic
1013707699 6:112858106-112858128 AAGGGGACAGAGAAAGAGACTGG + Intergenic
1014497297 6:122141455-122141477 AAGGACACACAGATAGAAAAAGG - Intergenic
1014504939 6:122243190-122243212 AAAGGCACACTGAAGAAGGAAGG + Intergenic
1015181818 6:130368877-130368899 AAGGGCACCAAGGAGCAGAAAGG - Intronic
1015255832 6:131178729-131178751 CAGGTCAAACAGAAGGAGATAGG - Intronic
1015808085 6:137132806-137132828 ATGGCCACACAGAAAAAGAAAGG + Intergenic
1016161323 6:140884000-140884022 AAGGGGAAGGAGAAGGAGAACGG - Intergenic
1016313789 6:142763285-142763307 AGTGGCACAGACAAGGAGAAGGG + Intronic
1016551428 6:145284323-145284345 TAGTGCACAAGGAAGGAGAATGG - Intergenic
1017316913 6:153042022-153042044 AAGGTCACACAGATAGAGATGGG + Intronic
1018448335 6:163879380-163879402 AAGGACAGACAGAAAAAGAAAGG + Intergenic
1018949576 6:168370533-168370555 CCGGGCACAGACAAGGAGAAGGG - Intergenic
1019575557 7:1735944-1735966 AAGGTCACACAGCAGGCGCACGG + Intronic
1019840921 7:3442756-3442778 AAGAACACACAAAAGGAAAAAGG - Intronic
1020087155 7:5316702-5316724 AAGGACACAAAGAATGGGAAAGG + Intronic
1020581352 7:10006772-10006794 AAAGGAACAAAGAAGGGGAAAGG - Intergenic
1021352633 7:19613804-19613826 AAGGGCACAGCCAAGGACAAAGG - Intergenic
1021395012 7:20136743-20136765 AAGTTCATACAGAAGGAGGAGGG + Exonic
1021396769 7:20159005-20159027 AAGTAAAGACAGAAGGAGAAAGG - Exonic
1021638036 7:22710622-22710644 AAGGGAAAACAGAATGAAAAGGG + Intergenic
1022014918 7:26341335-26341357 AAGGTAAGAGAGAAGGAGAATGG + Intronic
1022100031 7:27164067-27164089 AAGAGGACAGAGTAGGAGAAAGG - Intronic
1022273710 7:28835638-28835660 GAGGACCCACAGAAGGACAAAGG + Intergenic
1023043574 7:36193385-36193407 AATGCCACACAGGAGGACAAAGG + Intronic
1023718826 7:43072288-43072310 AAGAGGACAGAGGAGGAGAAAGG + Intergenic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024882554 7:54105829-54105851 AAGGGCACACAGACAGACATTGG + Intergenic
1025279179 7:57614562-57614584 GTGGGCCCACAGAAGGGGAAGGG - Intergenic
1025305552 7:57850938-57850960 GTGGGCCCACAGAAGGGGAAGGG + Intergenic
1026111844 7:67464718-67464740 AAGGCAACACAGAGTGAGAAGGG - Intergenic
1026350014 7:69507677-69507699 AGGGGGACACAGAACGACAATGG + Intergenic
1026488767 7:70845415-70845437 AAGGGAAATCAGAAAGAGAAAGG + Intergenic
1026905054 7:74058007-74058029 AAGGAGAAAGAGAAGGAGAAGGG - Intronic
1026946749 7:74321058-74321080 AGGGTCACACAGCAGGAGCAGGG - Intronic
1027226685 7:76248161-76248183 AGGGGCACAGAGAGGGTGAAGGG - Intronic
1027309270 7:76937238-76937260 AAGGGCATACAGAGGGAGACTGG - Intergenic
1027366111 7:77460112-77460134 AAGAGGCCACAGTAGGAGAATGG + Intergenic
1027733056 7:81900672-81900694 AAGGACTCACATAAGGTGAAGGG - Intergenic
1028863354 7:95679701-95679723 ATGGGCACACAGAACTGGAAGGG - Intergenic
1029204655 7:98862337-98862359 AAGGGAAAACAGAGAGAGAAGGG + Intronic
1029460374 7:100690906-100690928 AGGGGCACACAAAGGGGGAATGG + Intergenic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029578771 7:101421032-101421054 GAGGGCACAAAGGAGGGGAAGGG - Intronic
1029612537 7:101634896-101634918 AATGGCTGACAGGAGGAGAAAGG + Intergenic
1029974781 7:104822771-104822793 AGGGGCAAACACAGGGAGAAAGG + Intronic
1030380258 7:108803247-108803269 AAGGGAAGAAAGAAGGGGAAGGG - Intergenic
1031949362 7:127876117-127876139 AAGGACAAAGAGAAGGAGAGGGG - Intronic
1032071383 7:128809495-128809517 AAGGCCAGCCAGAAGGAGATGGG + Exonic
1032216806 7:129963794-129963816 AAGGTCACACAGACGGTAAATGG + Intergenic
1032486192 7:132289237-132289259 ATGGGCATACAAGAGGAGAAGGG - Intronic
1032525040 7:132573643-132573665 GAAGGCACAGAGAAGGAGAAAGG + Intronic
1032577733 7:133073294-133073316 AAGGGCACATAGAATGAGAAGGG - Intronic
1032642402 7:133784502-133784524 AACGCCACACACAAGAAGAACGG - Intronic
1032779463 7:135152192-135152214 AAGGTCACACAGCTGGTGAATGG + Intronic
1033648230 7:143321254-143321276 AGGGGCACACAGAAGGAGCACGG + Intronic
1033656978 7:143381288-143381310 AGGGACACACGGAAGGAGGAGGG - Exonic
1034277269 7:149829401-149829423 AGGGGGACACAGGAGGAGGAGGG - Intergenic
1034381921 7:150704245-150704267 AAGGACACACAGAGGCTGAAAGG + Intergenic
1035014735 7:155755285-155755307 CAGGACACACAGAAGGACAGGGG - Intronic
1036561774 8:9904843-9904865 AAGAGCACTGAGGAGGAGAAGGG - Intergenic
1036569198 8:9964913-9964935 AGTGGCAAACAGAGGGAGAAAGG + Intergenic
1036949662 8:13129036-13129058 AAGGTCCCACAGAAGGAAAAGGG + Intronic
1037075294 8:14709101-14709123 AAGAGCACAAAAAAGGAGAAAGG - Intronic
1037463525 8:19136818-19136840 AAGGCCACACAGCTGGAGAAGGG - Intergenic
1037564480 8:20105935-20105957 AAGGCTGCACAGAGGGAGAAGGG + Intergenic
1037611722 8:20481534-20481556 AAGGGGACACAGAGGCACAAAGG - Intergenic
1037612038 8:20483994-20484016 AAAAGGACACAGAGGGAGAAAGG - Intergenic
1037918653 8:22788305-22788327 AGGGGGACAAAGAAGGAGCAGGG + Intronic
1038179828 8:25215560-25215582 GAGGGCACAGATAAGGAGAAAGG + Intronic
1039611269 8:38921225-38921247 AAGTACACAAAGGAGGAGAATGG - Intronic
1039929820 8:41975235-41975257 AAGGGCACCCAGAATGTGATGGG - Intronic
1040690960 8:49937872-49937894 AAAGGAACTCAGAAGGAGGAGGG - Intronic
1041165675 8:55090176-55090198 AAGGGCACACAGATACACAAGGG - Intergenic
1041237669 8:55820831-55820853 AAGGACAGAGAGAGGGAGAACGG - Intronic
1041241766 8:55854446-55854468 AGGGGCAGACCAAAGGAGAAGGG - Intergenic
1041389213 8:57334149-57334171 AAGGAAGCACAGACGGAGAATGG - Intergenic
1042263574 8:66885539-66885561 AATGGCAAACAGAAAAAGAAAGG - Intronic
1042439344 8:68807890-68807912 AAGGCCACACTGGAGGAGTAAGG - Intronic
1042685206 8:71431167-71431189 AAGTGCAAAGAGAAAGAGAAAGG + Intronic
1042819225 8:72911929-72911951 AAGGGGAAACAGAAAGACAATGG - Intronic
1044402224 8:91786119-91786141 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044402229 8:91786137-91786159 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044503920 8:92993991-92994013 AAGGGCAGAAAGAACCAGAAAGG + Intronic
1045039747 8:98211823-98211845 AAAGACACAGAAAAGGAGAAGGG + Intronic
1045295546 8:100869178-100869200 AAAGTCACACAGCAGGAAAATGG - Intergenic
1045331099 8:101156327-101156349 AAGGTCACACAGAAGGCACATGG - Intergenic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1045652283 8:104352458-104352480 AGGAGAACACAGGAGGAGAATGG - Intronic
1047177604 8:122556231-122556253 AAGGTCACACAGAAGGGAAGTGG - Intergenic
1047177644 8:122556593-122556615 AAGGGGACAAAGAAGAAGGAAGG + Intergenic
1047417484 8:124677017-124677039 AAAGGCACACAGAAAAAAAAGGG + Intronic
1047468608 8:125144669-125144691 AGGGGCAAAATGAAGGAGAAAGG - Intronic
1047544464 8:125802480-125802502 AGGGGGAGAGAGAAGGAGAAGGG + Intergenic
1047938313 8:129803140-129803162 AGTGGCAAAGAGAAGGAGAAAGG - Intergenic
1048233973 8:132673002-132673024 AAGGGCACACAGGAGCAGTCAGG + Intronic
1048509695 8:135051144-135051166 AAACACACACAGAAAGAGAAAGG + Intergenic
1048590144 8:135813785-135813807 AAGGTCACACAGAGAGTGAATGG - Intergenic
1048821666 8:138385845-138385867 AAGGACACATAGAAGGAAACGGG + Intronic
1048922563 8:139244549-139244571 AAAGACAGACAAAAGGAGAAGGG + Intergenic
1049064527 8:140302308-140302330 AAGGGCACACACAGAGCGAAGGG - Intronic
1049287479 8:141783660-141783682 AATGGGAAACAGCAGGAGAAGGG + Intergenic
1050301132 9:4260010-4260032 ATGGAAACACAGAGGGAGAAAGG + Intronic
1050480680 9:6084288-6084310 AAGAGAACACAGAAGGGAAATGG + Intergenic
1051609215 9:18945132-18945154 AAGGGAAAACTGGAGGAGAATGG - Intronic
1051689075 9:19690262-19690284 ACGGACCCACAGTAGGAGAAAGG - Intronic
1052037701 9:23701634-23701656 AAGAGGGAACAGAAGGAGAAGGG + Intronic
1052093822 9:24361179-24361201 AAGGGAACATAGAAGAAGAGGGG + Intergenic
1052216813 9:25976050-25976072 AAGGGGAAGCAGAAGGTGAAGGG - Intergenic
1052302643 9:26971486-26971508 AAGAAAACACAGAAGGAAAATGG - Intronic
1052588480 9:30459774-30459796 AAGGGCATTCATAAGGACAAAGG + Intergenic
1053089191 9:35258316-35258338 AAGGCAAAACAGAAAGAGAAAGG - Intronic
1053377979 9:37624336-37624358 CAGGGCACACAGCAGGAGACAGG + Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055166297 9:73199512-73199534 AAGGGCACTGAGAGGGAGGATGG + Intergenic
1055717052 9:79129213-79129235 CAGGACACACAGAAGGACACAGG + Intergenic
1055870548 9:80873435-80873457 AAGTGTACAAAAAAGGAGAAGGG - Intergenic
1057076142 9:92139113-92139135 AAGGAGACAGAGAAGGAGCAGGG - Intergenic
1057438679 9:95065485-95065507 AAGGGCAGCCAGCAGGAGAAGGG - Intronic
1057858328 9:98619933-98619955 AAGGCCACACAGCAGGTGAGTGG - Intronic
1057891591 9:98874110-98874132 GATGGCACCCAGAAGGAGGAAGG - Intergenic
1058111228 9:101032462-101032484 AGGAGCACACAGAAGAAGGAAGG - Intronic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058555196 9:106159429-106159451 GGGGGCACAGAGAACGAGAAGGG + Intergenic
1058711524 9:107683468-107683490 AAGGGGATGCAGAGGGAGAAGGG - Intergenic
1059282043 9:113143269-113143291 TAGGGCACACAGCTGGTGAAGGG - Intergenic
1059362132 9:113753168-113753190 AAGGTCACACAGCAGGTTAACGG + Intergenic
1059576539 9:115495047-115495069 AAGGTCACACAGAAGGTCACTGG - Intergenic
1059663066 9:116420477-116420499 CAGGGCCCACAGAGGGTGAACGG + Intergenic
1060833512 9:126736133-126736155 AATAGCACAAAGAAGGGGAAGGG + Intergenic
1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG + Exonic
1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG + Intronic
1062352934 9:136148037-136148059 AAGGCCACACAGCAGGTGGAGGG + Intergenic
1062617294 9:137403585-137403607 AGGGGCAAAGAGAAGGAGAGAGG - Intronic
1062628887 9:137454854-137454876 AAGGACACAGAGCAGGAGAGGGG - Intronic
1203630562 Un_KI270750v1:69391-69413 GTGGGCCCACAGAAGGGGAAGGG - Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186129020 X:6446349-6446371 AAGAGCAAACAGAAGGGGAAGGG - Intergenic
1186243460 X:7594346-7594368 AAGTGCCTACAGAAGGAAAAAGG + Intergenic
1186470588 X:9818994-9819016 AAGGGCAAAGACAAGGAAAATGG - Intronic
1187048317 X:15671596-15671618 AATGACACAGAGAAGGACAATGG + Intergenic
1187393983 X:18904215-18904237 AGTGGAAAACAGAAGGAGAAGGG + Intronic
1187843796 X:23515450-23515472 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1189402681 X:40686981-40687003 AAGAGTATACAGAAGGAGATGGG - Intronic
1190259825 X:48790849-48790871 AGGGGCACACAGGAGTGGAACGG + Intronic
1190334283 X:49253034-49253056 GAGGGCACTCAGAGGGAGACAGG + Intronic
1191108426 X:56786990-56787012 TAGAGCATCCAGAAGGAGAACGG - Intergenic
1192318200 X:70067740-70067762 AAGGGGACCTGGAAGGAGAAGGG + Intergenic
1192451695 X:71248854-71248876 GAGAGCACACAGAAGGTGTAAGG + Intronic
1192600301 X:72456393-72456415 AATAGCACAAAGAAAGAGAAAGG + Intronic
1193135956 X:77970736-77970758 CAGGCCACACCGAAGGGGAAAGG + Intronic
1193138589 X:78001090-78001112 ATGGGCAAACAGAAATAGAAGGG - Intronic
1194143022 X:90228621-90228643 AGAGGCAAGCAGAAGGAGAAGGG - Intergenic
1194416098 X:93614057-93614079 GAAAGCACACAAAAGGAGAAAGG - Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1194584690 X:95717901-95717923 AAGGGCAGGCAGGAGGGGAAGGG + Intergenic
1194978712 X:100418070-100418092 AACGGCACCAAGAATGAGAAGGG - Intergenic
1195391717 X:104368971-104368993 AAGGGCATACAGGAGTATAAAGG + Intergenic
1195619050 X:106935015-106935037 AAAGGCAGACAGGATGAGAAAGG + Intronic
1195948814 X:110245265-110245287 AGGGGGTTACAGAAGGAGAAGGG - Intronic
1196122523 X:112066182-112066204 ATAGGAACACAGAAGCAGAAGGG - Intronic
1196551576 X:117032992-117033014 AACGTCACTCAGAAGGACAATGG + Intergenic
1196650046 X:118159286-118159308 AAGGGGAGAGAGAAAGAGAAAGG + Intergenic
1196961525 X:121008220-121008242 AAGGGCTCACAGAGGTACAAAGG - Intergenic
1197111942 X:122786111-122786133 AAAGGCACACATTAGCAGAATGG - Intergenic
1197723529 X:129760738-129760760 AAGGTCACACAGAAGGTTAGCGG + Intronic
1197829003 X:130621474-130621496 AATGGGACACAAAAGGAGTATGG - Intergenic
1197841541 X:130752927-130752949 GAGAACACACAGAAGGAGCAAGG - Intronic
1198145121 X:133848390-133848412 TAGAGCACACAGATAGAGAAGGG + Intronic
1199277298 X:145961498-145961520 AAGTACACTCAGAAGGGGAATGG + Intergenic
1199595922 X:149505622-149505644 AAGGCCTCATGGAAGGAGAATGG - Intronic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1200379716 X:155822221-155822243 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200379724 X:155822245-155822267 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200488775 Y:3797940-3797962 AGAGGCAAGCAGAAGGAGAAGGG - Intergenic
1200740412 Y:6847665-6847687 ATGGGAACAGAGAAGGAGAAGGG - Intergenic
1201453008 Y:14136324-14136346 AAGGGAAAAGAGAAGGAAAATGG - Intergenic
1202064938 Y:20929061-20929083 AAATGCACAAAGAAGTAGAACGG + Intergenic