ID: 1004999461

View in Genome Browser
Species Human (GRCh38)
Location 6:21226036-21226058
Sequence GAGAATCCTCAGATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 534}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004999454_1004999461 26 Left 1004999454 6:21225987-21226009 CCATTTTACAGGTGAGGAAATGG 0: 5
1: 136
2: 867
3: 3744
4: 10506
Right 1004999461 6:21226036-21226058 GAGAATCCTCAGATGGAGCTGGG 0: 1
1: 0
2: 1
3: 39
4: 534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004999461 Original CRISPR GAGAATCCTCAGATGGAGCT GGG Intronic
900412264 1:2518021-2518043 GCGAATCCTCCCATGGACCTGGG - Intronic
901108442 1:6776101-6776123 AAGAATCTTGAGATGGGGCTGGG + Intergenic
901261271 1:7873351-7873373 GTGATTCCTCTGATGGATCTGGG + Intergenic
901289324 1:8110636-8110658 GTGATTCCTCTGATGGATCTGGG + Intergenic
901487001 1:9571006-9571028 GAAAATCATCTGATGGGGCTGGG - Intronic
901751267 1:11410980-11411002 GTGATTCCTCTGATGGATCTGGG + Intergenic
901843437 1:11967256-11967278 GAGAAACCTGAGATGGAGTTTGG + Intronic
901891069 1:12265491-12265513 GTGATTCCTCTGATGGACCTAGG + Intronic
902092953 1:13918155-13918177 GTGATTCCTCTGATGGATCTGGG + Intergenic
902113978 1:14106188-14106210 GAGAACCCTCAGATACACCTTGG - Intergenic
904375661 1:30080657-30080679 TAGAAACCAGAGATGGAGCTAGG - Intergenic
904456336 1:30650403-30650425 GAGAGGCATCAGATGGAGCCAGG - Intergenic
904760708 1:32802449-32802471 GTGACTCCTCCGATGGATCTGGG - Intronic
905079017 1:35300340-35300362 GAGAATTCTTAAATGCAGCTGGG - Intronic
905757187 1:40520729-40520751 GAGATTCCTCTGATGGATTTGGG + Intergenic
906269702 1:44466502-44466524 GTGATTCCTCCGATGGATCTGGG - Intronic
906772119 1:48494595-48494617 GAGTATACTCTGATGGAGCAAGG - Intergenic
907290365 1:53409066-53409088 GGGAATCCCCTGAGGGAGCTAGG + Intergenic
907290411 1:53409193-53409215 GGGAATCCCCTGAGGGAGCTAGG + Intergenic
907290439 1:53409277-53409299 GGGAATCCCCTGAGGGAGCTAGG + Intergenic
907858854 1:58331015-58331037 GTGATTCCTCTGATGGATCTGGG + Intronic
907916907 1:58879022-58879044 GTGATTCCTCTGATGGATCTGGG + Intergenic
908975334 1:69890167-69890189 GTGATTCCTCACATGGACCTGGG - Intronic
909139814 1:71849143-71849165 GTGATTCCTCTGATGGATCTGGG + Intronic
909322198 1:74303724-74303746 GTGATTCCTCTGATGGATCTGGG + Intronic
909873898 1:80779214-80779236 GGGAATACTCAGATGGGGGTGGG - Intergenic
910151444 1:84151985-84152007 GTGATTCCTCTGATGGATCTGGG - Intronic
910163137 1:84295474-84295496 ATGATTCCTCTGATGGAGCTGGG - Intergenic
910200577 1:84694207-84694229 GTGATTCCTCTGATGGAACTGGG + Intergenic
911280968 1:95928270-95928292 GAAAAACGTTAGATGGAGCTGGG - Intergenic
911955674 1:104231688-104231710 GTGATTCCTCTGATGGATCTGGG - Intergenic
912032829 1:105271356-105271378 GTGATTCCTCTGATGGATCTGGG + Intergenic
912501279 1:110123763-110123785 GAGAATCCCCACATGAACCTGGG - Intergenic
912859578 1:113201475-113201497 GTGATTCCTCTGATGGACCTGGG + Intergenic
912954216 1:114142145-114142167 GTGATTCCTCTGATGGATCTGGG + Intronic
912954281 1:114143003-114143025 GTGATTCCTCTGATGGATCTGGG + Intronic
914415294 1:147474876-147474898 GTGACTCCTCTGATGGATCTGGG + Intergenic
914709531 1:150200282-150200304 GTGATTCCTCTGATGGATCTGGG - Intergenic
915970099 1:160348825-160348847 GATAACCTTCAGATGGAGCTGGG + Intronic
916831828 1:168500644-168500666 GTGATTCCTCTGATGGAGCTGGG - Intergenic
916847155 1:168663350-168663372 GTGATTCCTCTGATGGACCTGGG + Intergenic
917193010 1:172438287-172438309 GTGATTCCTCTGATGGATCTAGG + Intronic
919006516 1:191906114-191906136 GAGAATCATCCCATGGAGCATGG + Intergenic
919683461 1:200458785-200458807 GAAAATACTCAGCTGGATCTAGG + Intergenic
920491153 1:206416390-206416412 GAGAATCCTCAAATGCAGGAGGG + Intronic
921281926 1:213575853-213575875 CAGCATCCTCATATTGAGCTGGG - Intergenic
921292106 1:213668176-213668198 GTGATTCCTCTGATGGATCTGGG - Intergenic
921402550 1:214741914-214741936 GTGATTCCTCTGATGGATCTGGG - Intergenic
921641448 1:217559733-217559755 GAGAAACCAGAGATTGAGCTGGG + Intronic
922333247 1:224596602-224596624 GTGATTCCTCTGATGGATCTGGG + Intronic
922389458 1:225124815-225124837 GTGATTCCTCTGATGGATCTAGG - Intronic
922727852 1:227932582-227932604 GTGATTCCTCTGATGGATCTAGG - Intronic
1062897252 10:1113498-1113520 GTGATTCCTCTGATGGACCTTGG + Intronic
1062995762 10:1865020-1865042 GTGAGTCCTCTGATGGATCTAGG + Intergenic
1063461744 10:6219211-6219233 GCGGATCCTCACGTGGAGCTCGG + Intronic
1064099548 10:12451485-12451507 GGAAATCCTCAAATGGAGCCAGG - Intronic
1065019692 10:21494362-21494384 GAGAAGCCTGGGAAGGAGCTTGG + Exonic
1065059169 10:21880397-21880419 GTGATTCCTCTGATGGATCTGGG - Intronic
1065351355 10:24798260-24798282 TACAATCCACAGATGGTGCTGGG - Intergenic
1065358205 10:24863611-24863633 GTGATTCCTCTGATGGATCTGGG + Intronic
1065571172 10:27072310-27072332 AAGAATCCACAGAAGGAGCTGGG - Intronic
1067275667 10:44831289-44831311 GTGATTCCTCTGATGGATCTGGG - Intergenic
1068218288 10:54010845-54010867 GAGAATGCTCAGCTGGAGATGGG - Intronic
1069338568 10:67383475-67383497 GAGAATCTTAATATGCAGCTAGG - Intronic
1069795299 10:71048042-71048064 GAGAATCCAGAGATGGACCCAGG + Intergenic
1069830600 10:71280103-71280125 GTGAAGTCTCACATGGAGCTAGG - Intronic
1069938021 10:71932475-71932497 GTGATTCCTCTGATGGATCTGGG - Intergenic
1070420701 10:76234037-76234059 GTGATTCCTCTGATGGATCTGGG - Intronic
1071132645 10:82413147-82413169 GTGATTCCTCTGATGGATCTGGG - Intronic
1073404115 10:103281888-103281910 GAGAGACCCCAGCTGGAGCTGGG + Intronic
1074474559 10:113758206-113758228 GTGATTCCTCTGATGGATCTGGG - Intronic
1074725518 10:116304284-116304306 GTGATTCCTCTGATGGATCTGGG - Intergenic
1075010204 10:118861790-118861812 GTGATTCCTCTGATGGATCTGGG + Intergenic
1076095302 10:127729979-127730001 GTGATTCCCCTGATGGAGCTGGG - Intergenic
1076444200 10:130500699-130500721 GAGAATCCACAGACAGTGCTGGG + Intergenic
1076742739 10:132495248-132495270 GTGATTCCTCTGATGGATCTGGG + Intergenic
1077384738 11:2263551-2263573 GAGACCCCTCAGAGGGGGCTGGG + Intergenic
1077514717 11:2994512-2994534 GTGGATCCTCTGAGGGAGCTGGG + Intergenic
1077616826 11:3681393-3681415 GCGATTCCTCTGATGGATCTGGG - Intronic
1077755394 11:5023600-5023622 GTGATTCCTCTGATGGATCTGGG - Intergenic
1078117638 11:8469640-8469662 GTGATTCCTCTGATGGATCTGGG - Intronic
1078193568 11:9114779-9114801 GTGATTCCTCTGATGGACCTGGG - Intronic
1078657331 11:13253886-13253908 GAGAATCCTAGGAGGTAGCTGGG + Intergenic
1079272557 11:19002197-19002219 GTGATTCCTCTGATGGATCTGGG + Intergenic
1081457403 11:43237785-43237807 GTGAGTCCTCTGATGGATCTGGG + Intergenic
1081652934 11:44837114-44837136 GTGATTCCTCTGATGGATCTGGG + Intronic
1081710982 11:45215197-45215219 GAGAAGCCTCAGATCTAGGTGGG - Intronic
1083568049 11:63737127-63737149 CGGAATTCTAAGATGGAGCTGGG - Intronic
1084116624 11:67046252-67046274 CAGAACCCTGAAATGGAGCTTGG - Intronic
1084505059 11:69560849-69560871 GCGATTCCTCTGATGGATCTGGG - Intergenic
1084680845 11:70665433-70665455 GAAAATTCTCAGATGGAGCAGGG - Intronic
1084739023 11:71126566-71126588 CAGATTCCTCAGATGGAGCTGGG + Intronic
1084847816 11:71914187-71914209 GCGATTCCTCTGATGGATCTAGG + Intronic
1085373058 11:76029402-76029424 GTGATTCCTCTGATGGATCTGGG + Intronic
1085441114 11:76563394-76563416 GTGAGTCCTCTGATGGATCTGGG - Intergenic
1085724920 11:78946610-78946632 GTGATTCCTCTGATGGATCTGGG + Intronic
1086646894 11:89233514-89233536 GTGATTCCTCTGATGGATCTGGG - Intronic
1086674514 11:89589132-89589154 GAGAGACTCCAGATGGAGCTAGG - Intergenic
1087736007 11:101835011-101835033 GTGACTCCTCTGATGGATCTTGG + Intronic
1088389293 11:109296607-109296629 GTGATTCCTCAGATGGATCTGGG - Intergenic
1088518565 11:110667636-110667658 GTGATTCCTCTGATGGATCTGGG + Intronic
1088567967 11:111193250-111193272 GTGATTCCTCTGATGGATCTGGG + Intergenic
1089338766 11:117743635-117743657 GAGAGTCTTCAGAAGGATCTGGG - Intronic
1091515460 12:1176103-1176125 GTGATTCCTCTGATGGATCTGGG - Intronic
1092178972 12:6431809-6431831 GAGAATCCTCAGGAGGAGTGGGG + Intergenic
1092622875 12:10292327-10292349 GTGATTCCTCAGATGAAACTGGG - Intergenic
1093662162 12:21769564-21769586 GTGAGTCCTGTGATGGAGCTGGG + Intronic
1093766650 12:22971165-22971187 GAAAATCCTGAGATGGCTCTTGG - Intergenic
1093896449 12:24579975-24579997 GAGAAGTTTCAGATGGAGCATGG + Intergenic
1094637179 12:32237957-32237979 GTGATTCCTCTGATGGATCTGGG + Intronic
1095233242 12:39767080-39767102 GTGATTTCTCAGATGGATCTGGG - Intronic
1096488457 12:52000028-52000050 GAGAATTCTCAGAAGGACCCAGG - Intergenic
1096848133 12:54419011-54419033 GAGAATCCGAAGAAGGAGCCCGG + Exonic
1097359986 12:58648216-58648238 GAGGATCCTCAGGAGAAGCTTGG + Intronic
1097659433 12:62412935-62412957 GTGATTCCTCTGATGGATCTGGG - Intronic
1098075085 12:66720968-66720990 GTGATTCCTCTGATGGATCTGGG - Intronic
1098427216 12:70378474-70378496 GTGATTCCTCTGATGGATCTGGG - Intronic
1098936806 12:76489825-76489847 GTGATTCCTCTGATGGATCTGGG + Intronic
1099218457 12:79882213-79882235 GTGATTCCTCTGATGGATCTGGG + Intronic
1099415128 12:82375102-82375124 GAGAATCAGCAGAGGAAGCTGGG + Intronic
1099474159 12:83087475-83087497 GTGATTCCTCTGATGGATCTGGG - Intronic
1099480839 12:83164324-83164346 GAGATTCCTCTGATGCATCTGGG - Intergenic
1099614167 12:84913207-84913229 GAGAATATTCAGATGGTGCCAGG - Intronic
1100618820 12:96252420-96252442 GTGATTCCTCTGATGGATCTGGG + Intronic
1101149306 12:101869909-101869931 GTGATTCCTCTGATGGATCTGGG + Intergenic
1102797829 12:115704220-115704242 GAGAAACCCCAGATAGAGATGGG - Intergenic
1103048215 12:117756725-117756747 GTGATTCCTCTGATGGATCTGGG + Intronic
1105288549 13:19029429-19029451 GTGATTCCTCTGATGGATCTGGG - Intergenic
1105393122 13:20000859-20000881 GTGATTCCTCTGATGGATCTAGG + Intronic
1105554950 13:21438242-21438264 GTGATTCCTCTGATGGATCTAGG + Intronic
1105833719 13:24190415-24190437 GTGATTCCTCTGATGGATCTGGG + Intronic
1107143790 13:37035201-37035223 GTGATTCCTCTGATGGATCTGGG + Intronic
1107194287 13:37629387-37629409 GTGATTCCTCTGATGGATCTGGG + Intergenic
1107459000 13:40582940-40582962 GTGATTCCTCTGATGGATCTGGG - Intronic
1108000049 13:45897404-45897426 GAGAATCATCACACGGAACTGGG - Intergenic
1108000636 13:45902669-45902691 CTTAATACTCAGATGGAGCTGGG - Intergenic
1108010255 13:45999765-45999787 GTGATTCCTCTGATGGATCTGGG - Intronic
1109953365 13:69532117-69532139 GAAATTCCTCTGATGGATCTTGG + Intergenic
1110411566 13:75209307-75209329 GTGATTCCTCTGATGGATCTGGG - Intergenic
1110766586 13:79286289-79286311 GGGATTCCTCTGATGGATCTGGG + Intergenic
1111299685 13:86331736-86331758 GAGAATCCTTAGAAGCAGCAAGG - Intergenic
1111401896 13:87748690-87748712 GTGATTCCTCTGATGGATCTGGG + Intergenic
1111860719 13:93702066-93702088 GTGATTCCTCTGATGGATCTGGG - Intronic
1111971434 13:94921320-94921342 TAGACTCCTCAGATGGAGAAGGG + Intergenic
1112208687 13:97350962-97350984 GTGATTCCTCTGATGAAGCTGGG - Intronic
1112563106 13:100531198-100531220 GACAATTATCAGATGGAGGTGGG + Exonic
1112852953 13:103729324-103729346 GAGAAGCCTCTGAGGGAGCATGG + Intergenic
1112978968 13:105357618-105357640 GTGATTCCTCTGATGGATCTGGG + Intergenic
1113486895 13:110660421-110660443 GTGATTCCTCTGATGGAGCTGGG - Intronic
1113722588 13:112571212-112571234 GTGATTCCTCTGATGGATCTGGG - Intronic
1113980902 13:114274553-114274575 GTGATTCCTCAGATGGATCTGGG - Intergenic
1114601881 14:23962795-23962817 GTGATTCCTCTGATGGATCTCGG - Intronic
1117074155 14:52084571-52084593 GTGATTCCTCTGATGGATCTGGG - Intergenic
1117269665 14:54129641-54129663 GTGATTCCTCTGATGGATCTGGG + Intergenic
1117401365 14:55361104-55361126 GTGATTCCTCTGATGGATCTGGG - Intronic
1121018556 14:90564117-90564139 GTGATTCCTCTGATGGATCTGGG - Intronic
1121036521 14:90708758-90708780 GTGATTCCTCTGATGGATCTGGG + Intronic
1121165666 14:91794868-91794890 GTGATTCCTCTGATGGACCTGGG + Intronic
1121252300 14:92508657-92508679 GTGATTCCTCTGATGGATCTGGG - Intergenic
1123013653 14:105362486-105362508 GTGATTCCTCTGATGGATCTGGG - Intronic
1124901696 15:33829380-33829402 GTGATTCCTCTGATGGATCTGGG + Intronic
1125552172 15:40553450-40553472 GAGAAGCCCCAGATGGGGCTTGG + Intronic
1125822566 15:42645215-42645237 GTGATTCCTCTGATGGATCTGGG - Intronic
1125981546 15:44006516-44006538 GTGATTCCTCTGATGGATCTAGG + Intronic
1127148120 15:56046717-56046739 GTGATTCCTCTGATGGATCTGGG - Intergenic
1127342728 15:58065180-58065202 TAGTATCCTCAGATGGAGGCCGG - Intronic
1128629220 15:69246353-69246375 GTGATTCCTCTGATGGATCTAGG - Intronic
1129126359 15:73444763-73444785 GTGATTCCTCTGATGGATCTGGG - Intronic
1129575337 15:76737157-76737179 GTGATTCCTCTGATGGATCTGGG - Intronic
1130197602 15:81795352-81795374 GGGGATCCTCAAATAGAGCTGGG - Intergenic
1130963786 15:88682268-88682290 GAGAACCCGCACATGGACCTGGG + Intergenic
1133623058 16:7544624-7544646 GAGAGCCTTCAGATGGAGCATGG + Intronic
1135801785 16:25504041-25504063 GCAAAACCTAAGATGGAGCTGGG - Intergenic
1136083578 16:27868723-27868745 GGCAACCCTCAGCTGGAGCTAGG + Intronic
1136594112 16:31235514-31235536 GTGATTCCTCTGATGGATCTAGG - Intergenic
1138246800 16:55473285-55473307 GTGATTCCTCTGATGGATCTGGG - Intronic
1138663845 16:58545814-58545836 GAGAATCCCCAGATAAACCTAGG - Intronic
1139914757 16:70421167-70421189 AAGACTGCTCAGCTGGAGCTCGG - Intronic
1140711541 16:77682834-77682856 TGGAATCCTCAGATGGAGAAAGG + Intergenic
1141487379 16:84349742-84349764 GAGGATCCTGAGATGGAGAGAGG + Intergenic
1142147270 16:88497838-88497860 GAGATTAGTCAGATGGAGCTCGG - Intronic
1142734332 17:1885798-1885820 GTGATTCCTCTGATGGATCTGGG - Intronic
1142908686 17:3067966-3067988 GTGATTCCTCTGATGGATCTGGG - Intergenic
1142925878 17:3236279-3236301 GTGATTCCTCTGATGGATCTGGG + Intergenic
1142953193 17:3501217-3501239 GTGATTCCTCTGATGGAGCTGGG + Exonic
1143485169 17:7250282-7250304 GAGAATCCTCGGAAGGAGTCTGG - Intronic
1144165527 17:12606555-12606577 GTGATTCCTCTGATGGATCTGGG - Intergenic
1144324599 17:14166973-14166995 GTGATTCCTCTGATGGATCTGGG + Intronic
1144682495 17:17205160-17205182 GAGAATCCTCAGGTGGGACAAGG + Intronic
1145716459 17:27027710-27027732 GTGATTCCTCTGATGGATCTGGG - Intergenic
1146412534 17:32599594-32599616 GTGATTCCTCTGATGGATCTGGG - Intronic
1147058803 17:37857135-37857157 GTGATTCCTCTGATGGATCTGGG - Intergenic
1147130829 17:38407717-38407739 GTGATTCCTCTGATGGATCTGGG - Intergenic
1147554875 17:41471677-41471699 GTGATTCCTCTGATGGATCTGGG - Intergenic
1147632148 17:41939093-41939115 GGGAATGCCCAGATTGAGCTGGG + Exonic
1148393439 17:47290085-47290107 GAGAGTCCTGAGATGAAGATTGG - Intronic
1148863277 17:50615544-50615566 GAGGTTCCTCAGCTGGAGGTGGG - Intronic
1150174352 17:63034549-63034571 GTGATTCCTCTGATGGATCTAGG + Intronic
1150571525 17:66391130-66391152 GCGAGTCCTGAAATGGAGCTTGG + Intronic
1150905866 17:69336512-69336534 GAGAATCCTAAGAAAGAGCCAGG + Intergenic
1152220240 17:79060219-79060241 GAGATTCCTCTGATGGATCTGGG + Intergenic
1153288079 18:3474988-3475010 GTGATTCCTCTGATGGATCTGGG + Intergenic
1153292626 18:3516428-3516450 GTGAGTCCTCTGATGGACCTGGG - Intronic
1153569972 18:6460852-6460874 GTGATTCCTCTGATGGATCTGGG + Intergenic
1154249311 18:12730040-12730062 GTGATTCCTCTGATGGATCTGGG - Intergenic
1154471176 18:14703214-14703236 GTGATTCCTCTGATGGATCTGGG + Intergenic
1155511984 18:26587553-26587575 GTGATTCCTCTGATGGATCTGGG + Intronic
1156085768 18:33399883-33399905 GTGACTCCTCTGATGGATCTGGG - Intronic
1157680810 18:49604187-49604209 AAGAATACTCAGCTGGTGCTTGG + Intergenic
1158446348 18:57525523-57525545 GTGATTCCTCTGATGGATCTGGG + Intergenic
1159550041 18:69885460-69885482 GAGAAGCCTCAGAAGGAGGAAGG + Intronic
1159694964 18:71545485-71545507 GTGATTCCTCTGATGGATCTGGG - Intergenic
1161012278 19:1966161-1966183 GCAATTCCTCTGATGGAGCTGGG + Intronic
1164604460 19:29587458-29587480 GGGAATCGTCAGATAGAGCCTGG + Intergenic
1168347680 19:55658957-55658979 GAGGATGCTCAGGAGGAGCTGGG - Intronic
1168533313 19:57147681-57147703 GTGAATCCTCTGATGGATCGGGG + Intergenic
1168614945 19:57830086-57830108 GATACTCCTGAGGTGGAGCTGGG + Intronic
924980200 2:212490-212512 GTGATTCCTCTGATGGATCTGGG - Intergenic
925081593 2:1072734-1072756 GTGATTCCTCTGATGGATCTGGG + Intronic
926057644 2:9784394-9784416 GTAAATCCTCTGATGGATCTGGG + Intergenic
926703564 2:15820350-15820372 GAGAACCCGGAGCTGGAGCTGGG - Intergenic
927324532 2:21788783-21788805 GAGATTTCTCTGATGGATCTGGG - Intergenic
928227258 2:29461840-29461862 GTGATTCCTCTGATGGATCTGGG + Intronic
928586583 2:32765134-32765156 GTGATTCCTCTGATGGATCTGGG - Intronic
928622617 2:33106384-33106406 GTGATTCCTCTGATGGATCTGGG - Intronic
928726666 2:34181872-34181894 GTGATTCCTCTGATGGATCTGGG + Intergenic
929297871 2:40268919-40268941 GAGTAACCTCAGTTGCAGCTTGG + Intronic
929378495 2:41320347-41320369 CAAAATCTGCAGATGGAGCTGGG + Intergenic
929947058 2:46379750-46379772 GAGAGTCCACAGATGGACCTGGG + Intronic
930127837 2:47816549-47816571 GTGATTCCTCTGATGGATCTGGG - Intronic
931022460 2:58063777-58063799 ATGATTCCTCAGATGGATCTGGG + Intronic
931895353 2:66722789-66722811 GTGATTCCTCTGATGGATCTGGG + Intergenic
931955646 2:67421087-67421109 GTGATTCCTCTGATGGATCTGGG + Intergenic
932116852 2:69058742-69058764 GTGATTCCTCTGATGGATCTTGG + Intronic
932175428 2:69596587-69596609 GAGGCTCCTCTGATGGACCTGGG + Intronic
932186024 2:69696598-69696620 GTGATTCCTCTGATGGATCTGGG - Intronic
933414299 2:81966397-81966419 GTGATTCCTCTGATGGATCTGGG + Intergenic
934869816 2:97853227-97853249 GTGATTCCTCTGATGGATCTGGG + Intronic
935036790 2:99384537-99384559 GAGATTCCTCTGATGGATTTGGG + Intronic
935282428 2:101529614-101529636 GGGGATACCCAGATGGAGCTTGG + Intergenic
935608324 2:104993512-104993534 GTGATTCCTCTGATGGATCTGGG + Intergenic
936551663 2:113448077-113448099 GTGATTCCTCTGATGGATCTGGG - Intronic
936920332 2:117682125-117682147 GTGATTCCACAGATGGATCTGGG + Intergenic
937110102 2:119359446-119359468 GTGATTCCTCAGATGGATATGGG + Intronic
938022315 2:127916109-127916131 GTGATTCCTCTGATGGATCTGGG - Intergenic
938606483 2:132898510-132898532 GTGATTCCTCTGATGGATCTGGG - Intronic
938987141 2:136587961-136587983 GTGATTCCTCAGATGGATCTGGG - Intergenic
939817477 2:146913644-146913666 GTGATTCCTCCGATGGATCTGGG + Intergenic
939867869 2:147494873-147494895 GTGATTCCTCTGATGGATCTGGG + Intergenic
940449434 2:153818783-153818805 TAAAATGCTCAGATGGAGCAGGG - Intergenic
942199358 2:173555255-173555277 GTTAATGCTGAGATGGAGCTAGG + Intergenic
944153970 2:196592529-196592551 GAACATCCTCTGCTGGAGCTTGG - Exonic
944172274 2:196793130-196793152 GAGAAACATCAGATGGAGTGAGG - Exonic
944255861 2:197623140-197623162 GTGATTCCTCTGATGGATCTGGG + Intronic
944750197 2:202701521-202701543 GTGATTCCTCTGATGGATCTGGG + Intronic
945666636 2:212751904-212751926 GGGATTCCTCTGATGGATCTGGG + Intergenic
945674395 2:212838246-212838268 GTGATTCCTCTGATGGATCTGGG - Intergenic
945756915 2:213857768-213857790 GTGATTCCTCTGATGGATCTGGG + Intronic
945894644 2:215468295-215468317 GTGATTCCTCTGATGGATCTGGG - Intergenic
946264901 2:218531618-218531640 GTGATCCCTCTGATGGAGCTAGG + Intronic
946343774 2:219091165-219091187 GAGAGTCCTCAGCTGGAATTGGG - Intronic
947234699 2:227928162-227928184 GTGATTCCTCTGATGGATCTTGG + Intergenic
947256408 2:228169891-228169913 GTGATTCCTCTGATGGATCTGGG + Intronic
947786397 2:232825251-232825273 GTGATTCCTCTGATGGATCTGGG + Intronic
1169159640 20:3366166-3366188 TAGATTCCTCTGATGGATCTGGG - Intronic
1169485290 20:6025616-6025638 GTGATTCCTCTGATGGATCTGGG + Intronic
1169488796 20:6054386-6054408 GAGGATCCTCAGAAGGGTCTGGG + Intergenic
1169616348 20:7450534-7450556 GTGATTCCTCTGATGGATCTAGG + Intergenic
1171084566 20:22225571-22225593 GACAAACCTCACATGGAGCCTGG - Intergenic
1171236614 20:23531599-23531621 GTGATTCCTCTGATGGATCTGGG - Intergenic
1171452560 20:25246844-25246866 GTGAATCCCGAGCTGGAGCTGGG + Intergenic
1171941035 20:31330224-31330246 CAGAGGCCTCAGCTGGAGCTGGG - Intergenic
1173313270 20:41919725-41919747 GTGATTCCTCTGATGGATCTGGG - Intergenic
1174539633 20:51278745-51278767 GAAAATCCTCTAATGGGGCTGGG - Intergenic
1174991224 20:55512515-55512537 GTGATTCCTCTGATGGATCTGGG - Intergenic
1175250489 20:57607107-57607129 GTGATTCCTCAGATGGATCTGGG + Intronic
1175329744 20:58155369-58155391 GGGAAGCCTCAGGTGAAGCTGGG - Intronic
1176803311 21:13454725-13454747 GTGATTCCTCTGATGGATCTGGG - Intergenic
1176950971 21:15046170-15046192 GTGATTCCTCTGATGGATCTGGG - Intronic
1177447940 21:21222361-21222383 GTGATTCCTCTGATGGATCTGGG + Intronic
1178070766 21:28963713-28963735 GTGATTCCTCTGATGGATCTGGG + Intronic
1178419863 21:32434772-32434794 TAGCATCCTCAGATGGAGCGTGG + Intronic
1179428556 21:41303059-41303081 GTGATTCCTCTGATGGATCTTGG - Intergenic
1179429062 21:41306397-41306419 GTGATTCCTCTGATGGATCTGGG - Intronic
1179772134 21:43629193-43629215 GTGATTCCTCTGATGGATCTGGG + Intronic
1179814028 21:43891930-43891952 GTGATTCCTCTGATGGATCTGGG - Intronic
1180113469 21:45678375-45678397 GTGATTCCTCTGATGGATCTGGG + Intronic
1180115665 21:45703286-45703308 GTGATTCCTCTGATGGATCTGGG - Intronic
1181515894 22:23412630-23412652 GTGATTCCTCTGATGGATCTGGG + Intergenic
1182605305 22:31498343-31498365 GTGATTCCTCTGATGGATCTGGG + Intronic
1182734792 22:32525057-32525079 GTGATTCCTCTGATGGATCTTGG + Intronic
1183234120 22:36603980-36604002 GTGATTCCTCTGATGGATCTGGG + Intronic
1185097047 22:48815178-48815200 GTGATTCCTCTGATGGACCTGGG + Intronic
1185101202 22:48841805-48841827 GAGGATCTGCAGATGGAGCTGGG + Intronic
1185103236 22:48852867-48852889 GAGGATCTGCAGATGGAGCTGGG - Intergenic
1185178153 22:49342636-49342658 GTGATTCCTCTGATGGATCTGGG + Intergenic
950112728 3:10430288-10430310 GTGATTCCTCTGATGGATCTGGG + Intronic
950562200 3:13738558-13738580 GTGATTCCTCTGATGGATCTGGG + Intergenic
950700246 3:14739155-14739177 GTGATTCCTCTGATGGATCTGGG - Intronic
950838642 3:15945225-15945247 GTGAATCCTCTGATAGAGCTGGG + Intergenic
951176248 3:19604061-19604083 GTGAGTCCTCTGATGGATCTGGG - Intergenic
951373398 3:21881697-21881719 GTGACTCCTCTGATGGATCTGGG + Intronic
951506827 3:23456403-23456425 GTGATTCCTCTGATGGATCTGGG - Intronic
952515557 3:34101196-34101218 GTGATTCCTCTGATGGATCTGGG - Intergenic
953730133 3:45440169-45440191 GAGAATCATCTGATGTAGCCTGG + Intronic
953863465 3:46564519-46564541 GAGCATCCTAAGAAGGATCTGGG + Intronic
954452168 3:50577560-50577582 GAGAATGCTCAGAGGTAGGTGGG + Exonic
954503186 3:51041110-51041132 GTGATTCCTCTGATGGATCTGGG - Intronic
955171332 3:56568115-56568137 GAGAATCCTCAGAGAAAGCCTGG + Intronic
955593633 3:60564471-60564493 GTGACTCCTCTGATGGATCTGGG + Intronic
955938407 3:64124951-64124973 GTGATTCCTCTGATGGATCTGGG + Intronic
956643716 3:71436303-71436325 GAAAATCCTAAGATGCAGCCTGG + Intronic
958119134 3:89262350-89262372 TAGAATCCTCAGAGGGAGTATGG - Intronic
958267889 3:91461045-91461067 GTGATTCCTCTGATGGATCTAGG + Intergenic
958452201 3:94287580-94287602 GTGATTCCTCTGATGGATCTGGG + Intergenic
958634027 3:96719482-96719504 GAGATTCCTCCAATGGATCTGGG + Intergenic
959357008 3:105344498-105344520 GACTACCCTCAGATGGAGGTTGG - Intergenic
959413159 3:106050244-106050266 GTGATTCCTCTGATGGATCTGGG + Intergenic
959873602 3:111356613-111356635 GTGATTCCTCAGATGGATCCAGG + Intronic
960160462 3:114344730-114344752 GTTAATCCTCATATGGAGCTTGG - Intronic
960599562 3:119442534-119442556 GAGATTCCTCCAATGGATCTGGG + Intronic
960669426 3:120142043-120142065 GTGATTCCTCAGATGGATCTGGG + Intergenic
961411516 3:126725134-126725156 GTGACTCCTCTGATGGACCTGGG - Intronic
961884136 3:130084734-130084756 TAGCATCCTCAGAGGGAGCCTGG - Intronic
961962895 3:130870374-130870396 GTGATTCCTCTGATGGATCTGGG + Intronic
962748180 3:138413130-138413152 TCGACTTCTCAGATGGAGCTGGG - Intergenic
962962309 3:140321945-140321967 GAGCATCCTCAGCTGGTGTTTGG + Intronic
963168250 3:142226123-142226145 GAGATTCTTCAAATGTAGCTAGG - Intergenic
963293093 3:143513624-143513646 GTGATTCCTCTGATGGATCTGGG - Intronic
963798048 3:149650725-149650747 GACACTTCTCAGATGGAGTTGGG + Intronic
964061436 3:152529099-152529121 GTGATTCCTCTGATGGATCTGGG - Intergenic
964823426 3:160798812-160798834 GTGATTCCTCTGATGGATCTGGG + Intronic
965981118 3:174692138-174692160 GTGATTCCTCTGATTGAGCTGGG - Intronic
966611912 3:181875936-181875958 GAAAATTCTCAGCTGGAGCCTGG - Intergenic
966644568 3:182230220-182230242 GTGATTCCTCTGATGGATCTGGG - Intergenic
966995640 3:185277600-185277622 GTGATTCCTCTGATGGATCTGGG - Intronic
968486088 4:863002-863024 CAGATTCCTCTGATGGATCTGGG + Intronic
968863591 4:3192831-3192853 GAGTATCCTCAAATGGACCAAGG - Intronic
969451990 4:7279262-7279284 GAAAAACATCAGATGGAGCTAGG + Intronic
970142302 4:12995939-12995961 TAGTATCCTCAGAAAGAGCTAGG - Intergenic
970528858 4:16961865-16961887 GTGATTCCTCTGATGGATCTGGG + Intergenic
970895583 4:21099683-21099705 GTGAGTCCTCTGATGGATCTGGG + Intronic
971071290 4:23095312-23095334 GTGATTCCTCTGATGGATCTTGG + Intergenic
971441357 4:26690914-26690936 GTGATTCCTCTGATGGATCTGGG + Intronic
971444847 4:26732258-26732280 GACAATCATCACATGAAGCTAGG + Intronic
972708185 4:41566315-41566337 GTGATTCCTCTGATGGATCTGGG - Intronic
972768865 4:42177085-42177107 GTGATTCCTCTGATGGATCTTGG - Intergenic
973658289 4:53074506-53074528 GTGATTCCTCTGATGGATCTGGG - Intronic
973697327 4:53503298-53503320 GTGATTCCTCTGATGGATCTGGG - Intronic
975323087 4:73030486-73030508 GTGATTCCTCTGATGGATCTGGG + Intergenic
975701785 4:77074861-77074883 GAGGAGCCTCCGCTGGAGCTAGG - Intronic
975921652 4:79398060-79398082 GAGAATGCGGAGCTGGAGCTCGG + Intergenic
977328376 4:95605816-95605838 GAGAAACGTCAAATTGAGCTCGG - Intergenic
977355969 4:95947034-95947056 GTGATTCCTCTGATGGATCTGGG - Intergenic
977594325 4:98862186-98862208 GATAATGCTCATGTGGAGCTTGG + Intergenic
978010194 4:103672300-103672322 GTGATTCCTCTGATGGATCTGGG - Intronic
979190151 4:117846904-117846926 GTGATTCCTCTGATGGATCTTGG + Intergenic
979313913 4:119236927-119236949 GAGATTCCTCTGATGGAACTGGG - Intronic
979576912 4:122303520-122303542 GTGATTCCTCAGATGGATCTGGG + Intronic
979619180 4:122779273-122779295 GTGATTCCTCAGATGGAGGTGGG - Intergenic
980185309 4:129453866-129453888 GAGAACCCTCAGATGAAGTCAGG + Intergenic
980706940 4:136510457-136510479 GTGATTCCTCTGATGGATCTGGG - Intergenic
980768058 4:137333945-137333967 GTGATTCCTCTGATGGATCTTGG - Intergenic
981462018 4:145024373-145024395 GTGATTCCTCTGATGGAACTGGG - Intronic
981959884 4:150523742-150523764 GACTATCCTCAGAGGGAGGTGGG + Intronic
982149489 4:152437071-152437093 GTGAATCCTCTGATGGATCTGGG + Intronic
983701878 4:170606896-170606918 GTGATTCCTCTGATGGACCTGGG - Intergenic
983963330 4:173780489-173780511 GTGATTCCTCTGATGGAACTGGG + Intergenic
984084262 4:175288964-175288986 GTGATTCCTCTGATGGACCTGGG - Intergenic
984461165 4:180038851-180038873 GTGATTCCTCTGATGGATCTGGG + Intergenic
986162104 5:5239566-5239588 GAGAATCCACATTTGGAACTGGG - Intronic
986371239 5:7082359-7082381 CAGAGTCCTTAGAGGGAGCTTGG + Intergenic
987865449 5:23529692-23529714 CAGAATCCTCAGTTGGGACTTGG + Intergenic
988018699 5:25595963-25595985 GAGAATCCTCAGGTGGAATGGGG + Intergenic
989128664 5:38082161-38082183 GTGATTCCTCTGATGGATCTGGG + Intergenic
989225229 5:39019822-39019844 GTGATTCCTCTGATGGATCTGGG + Intronic
990068072 5:51743204-51743226 GTGAGTCCTCTGATGGATCTGGG - Intergenic
990151841 5:52827010-52827032 GTGATTCCTCTGATGGATCTAGG + Intronic
990481671 5:56217485-56217507 GTGATTCCTCTGATGGATCTGGG + Intronic
991394225 5:66186869-66186891 GTGATTCCTCCGATGGATCTGGG + Intergenic
991621937 5:68553923-68553945 GTGATTCCTCTGATGGAGCTTGG - Intergenic
991936141 5:71802526-71802548 GTGATTCCTCTGATGGATCTGGG - Intergenic
993893284 5:93500969-93500991 GCGATTCCTCTGATGGATCTGGG + Intergenic
993906274 5:93627384-93627406 GTGATTCCTCTGATGGATCTGGG - Intronic
993956217 5:94236139-94236161 GTGATTCCTCTGATGGACCTGGG + Intronic
995214297 5:109577265-109577287 GTGATTCCTCTGATGGATCTGGG - Intergenic
995339445 5:111041289-111041311 GTGACTCCTCTGATGGATCTGGG - Intergenic
995505649 5:112858171-112858193 GTGATTCCTCTGATGGATCTGGG - Intronic
996482857 5:123994814-123994836 GTGATTCCTCTGATGGATCTGGG - Intergenic
997717458 5:136052782-136052804 GAGGACCCTCAGATGAGGCTGGG - Intronic
997853606 5:137354369-137354391 GAGAAGCCTCAGTGGGAGCCAGG - Intronic
999573449 5:152946766-152946788 GAGATTCCTCAGAAGGAGTTTGG + Intergenic
999688096 5:154120665-154120687 GTGATTCCTCTGATGGATCTCGG + Intronic
999933188 5:156455974-156455996 GAGAAGTCTCAGAGGGAGCATGG + Intronic
1000081001 5:157847137-157847159 GTGATTCCTCTGATGGATCTGGG + Intronic
1000129418 5:158281215-158281237 GTGATTCCTCTGATGGATCTGGG + Intergenic
1000517610 5:162258740-162258762 GAGCATCCTCACATGGGGTTTGG - Intergenic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1001373219 5:171228146-171228168 GTGATTCCTCTGATGGATCTGGG + Intronic
1002065651 5:176650453-176650475 GAGCATCCTGGGAAGGAGCTCGG + Intronic
1003008211 6:2401504-2401526 GTGATTCCTCTGATGGATCTGGG + Intergenic
1003996092 6:11540741-11540763 GTGATTCCTCTGATGGACCTGGG - Intronic
1004053332 6:12109841-12109863 GTGATTCCTCTGATGGAGCTGGG - Intronic
1004067978 6:12268253-12268275 GCGATTCCTCTGATGGATCTGGG + Intergenic
1004999461 6:21226036-21226058 GAGAATCCTCAGATGGAGCTGGG + Intronic
1005045974 6:21642890-21642912 GAGATTCCTCTTATGGATCTGGG + Intergenic
1006245308 6:32729177-32729199 GTGATTCCTCTGATGGATCTGGG + Intergenic
1006744275 6:36330486-36330508 GAGCCTCTGCAGATGGAGCTGGG + Exonic
1008202444 6:48607688-48607710 GAGAAAACTGAGATGGAGCAAGG + Intergenic
1008268824 6:49464990-49465012 GTGATTCCTCTGATGGATCTGGG - Intronic
1008585701 6:52947026-52947048 GAGAATCCTCAGATTGAAAAAGG + Intergenic
1008939993 6:57036701-57036723 GTGATTCCTCTGATGGATCTGGG - Intergenic
1008987320 6:57560533-57560555 GTGATTCCTCTGATGGATCTAGG - Intronic
1009175278 6:60453085-60453107 GTGATTCCTCTGATGGATCTAGG - Intergenic
1009748034 6:67845863-67845885 GTGATTCCTCTGATGGATCTTGG - Intergenic
1011115796 6:83890158-83890180 GTGATTCCTCTGATGGATCTGGG + Intronic
1011645000 6:89449088-89449110 GTGATTCCTCTGATGGATCTGGG + Intronic
1012072948 6:94646127-94646149 AACAATCCCCAGATGGATCTAGG + Intergenic
1012564982 6:100637561-100637583 GTGATTCCTCTGATGGACCTGGG + Intronic
1013088710 6:106879147-106879169 GTGATTCCTCTGATGGATCTGGG - Intergenic
1014262614 6:119236795-119236817 GTGATTCCTCTGATGGATCTAGG + Intronic
1014354207 6:120383954-120383976 GTGATTCCTCTGATGGATCTTGG - Intergenic
1015144921 6:129975176-129975198 GTGATTCCTCTGATGGATCTGGG + Intergenic
1015648225 6:135420281-135420303 GTGATTCCTCTGATGAAGCTGGG - Intronic
1015653613 6:135492637-135492659 GTCAATCCTGAGATGGAGTTTGG - Intronic
1015746380 6:136514145-136514167 GTGATTCCTCTGATGGATCTGGG - Intronic
1015820043 6:137250892-137250914 GTGATTCCTTAGATGGAGCCAGG + Intergenic
1016131191 6:140473998-140474020 AATAATTCTCAGATGGAGGTGGG + Intergenic
1016344005 6:143092050-143092072 GTGATTCCTCTGATGGATCTGGG - Intronic
1016616788 6:146059141-146059163 GTGATTCCTCTGATGGATCTGGG - Intronic
1016754586 6:147669952-147669974 GTGATTCCTCTGATGGATCTGGG - Intronic
1016867497 6:148782159-148782181 GTGATTCCTCTGATGGATCTGGG + Intronic
1017183931 6:151581660-151581682 GTGATTCCTCTGATGGATCTGGG - Intronic
1017799667 6:157882497-157882519 GTGATTCCTCTGATGGATCTGGG + Intronic
1018028433 6:159823205-159823227 CAGAATCCACAGAAGGAGCTTGG - Intergenic
1018317554 6:162571723-162571745 GAGAAGCCTGGCATGGAGCTAGG + Intronic
1018818400 6:167353354-167353376 GTGATTCCTCAGATGGATCTGGG + Intronic
1020664645 7:11024930-11024952 GTGATTCCTCTGATGGATCTGGG + Intronic
1020758556 7:12238540-12238562 GTGATTCCTCTGATGGATCTGGG - Exonic
1020833408 7:13119500-13119522 GTGATTCCTCTGATGGATCTGGG + Intergenic
1021164759 7:17323798-17323820 GAAGATCCTCAGTTGGGGCTAGG - Intronic
1021285761 7:18779243-18779265 GAGAGTCTTGAAATGGAGCTGGG - Intronic
1021472142 7:21015841-21015863 GTGATTCCTCTGATGGATCTGGG - Intergenic
1022560865 7:31347566-31347588 GAGAATCATCATTTGGACCTAGG + Intergenic
1023476971 7:40591092-40591114 GTGATTCCTCCGATGGATCTGGG + Intronic
1023667413 7:42538416-42538438 GTGATTCCTCTGATGGATCTGGG + Intergenic
1023773151 7:43578107-43578129 GTGAATCTTCTGATGGATCTGGG - Intergenic
1024575388 7:50759436-50759458 GAGCATCCTCTGATGGATTTTGG - Intronic
1025938671 7:66057652-66057674 GTGATTCCTCTGATGGATCTGGG + Intergenic
1026855626 7:73752325-73752347 GTGATTCCTCTGATGGATCTGGG + Intergenic
1027490385 7:78816946-78816968 GGGATTCCTCTGATGGACCTGGG + Intronic
1027573574 7:79903084-79903106 GGGATTCCTCTGATGGATCTGGG + Intergenic
1028209950 7:88061375-88061397 GCGATTCCTCTGATGGATCTGGG - Intronic
1028408521 7:90502477-90502499 GTGATTCCTCTGATGGATCTGGG - Intronic
1028642448 7:93058252-93058274 GCGATTCCTCTAATGGAGCTGGG - Intergenic
1030827134 7:114171760-114171782 TAGATTCCTCTGATGGAACTGGG + Intronic
1030982353 7:116201019-116201041 TAGAACCCTCAGAGGGAGCATGG + Intergenic
1031307321 7:120146800-120146822 GTGACTCCTCTGATGGAACTTGG - Intergenic
1031418544 7:121521807-121521829 GAGAATACCCTCATGGAGCTGGG + Intergenic
1031883885 7:127225518-127225540 GAGAATGATCTGATGCAGCTAGG + Intronic
1032180795 7:129675447-129675469 GTGATTCCTCTGATGGATCTGGG - Intronic
1032374825 7:131402552-131402574 GTGATTCCTCTGATGGATCTGGG - Intronic
1032861892 7:135888003-135888025 GTGATTCCTCTGATGGATCTGGG + Intergenic
1032921122 7:136549383-136549405 AAGAATCCTCAGAGGCAGATAGG - Intergenic
1033028801 7:137804986-137805008 GAGAAACCCCAGAAGCAGCTGGG + Intronic
1033080435 7:138291703-138291725 GTGATTCCTCTGATGGATCTGGG - Intergenic
1033107421 7:138540780-138540802 GTGATTCCTCTGATGGATCTGGG - Intronic
1033642592 7:143276510-143276532 GTGATTCCTCTGATGGATCTGGG - Intergenic
1033795409 7:144839750-144839772 GTGATTCCTCTGATGGATCTGGG + Intergenic
1033813569 7:145046173-145046195 GAGAATGCACAGCTGGAGCATGG + Intergenic
1034404546 7:150894119-150894141 GTGATTCCTCTGATGGATCTGGG + Intergenic
1034568926 7:151939356-151939378 GTGATTCCTCTGATGGATCTGGG + Intergenic
1034873439 7:154703989-154704011 GTGATTCCTCTGATGGATCTGGG + Intronic
1034981287 7:155479071-155479093 GTGAGTCCTCTGATGGAGCTGGG + Intronic
1034984182 7:155497227-155497249 CAGAATCCTGAGAAGGGGCTGGG - Intronic
1035066857 7:156111718-156111740 GTGATTCCTCTGATGGATCTGGG - Intergenic
1035092288 7:156323567-156323589 GTGAATCCTCTGATGGATCTGGG - Intergenic
1035166993 7:156996903-156996925 GTGATTCCTCTGATGGATCTGGG - Intronic
1035426160 7:158775853-158775875 GTGATTCCTCTGATGGATCTGGG - Intronic
1035455155 7:159003807-159003829 GTGATTCCTCTGATGGATCTGGG - Intergenic
1036388218 8:8300612-8300634 GTGATTCCTCTGATGGATCTAGG - Intergenic
1037263513 8:17034478-17034500 GTGATTCCTCTGATGGATCTGGG + Intronic
1037435530 8:18858998-18859020 GTGATTCCTCTGATGGATCTGGG - Intronic
1037684522 8:21127409-21127431 GAGCTTCCTCAGATGTGGCTGGG - Intergenic
1039940572 8:42087127-42087149 GTGATTCCTCAGATGGATATGGG - Intergenic
1040033578 8:42847545-42847567 GTGACTCCTCTGATGGATCTGGG - Intergenic
1040036875 8:42879283-42879305 GTGATTCCTCTGATGGATCTGGG + Intronic
1040425564 8:47281850-47281872 GTGACTCCTCTGATGGATCTGGG - Intronic
1040754127 8:50749996-50750018 GTGATTCCTCTGATGGATCTTGG + Intronic
1040977122 8:53205830-53205852 GAGAACCTTCAGAGGGAGCCTGG + Intergenic
1041311208 8:56518781-56518803 GAGAAGCCTCAGATGGCTTTAGG - Intergenic
1042045287 8:64644414-64644436 GTGATGCCTCCGATGGAGCTGGG - Intronic
1042101605 8:65280681-65280703 TAGAAACTTCAGATGGAGCATGG - Intergenic
1042266311 8:66912031-66912053 ATGATTCCTCTGATGGAGCTGGG + Intronic
1043005503 8:74813233-74813255 GTGAATCCTCTGATGGATCTGGG + Intronic
1043238272 8:77897905-77897927 GTGATTCCTCTGATGGATCTGGG - Intergenic
1044461333 8:92447866-92447888 GTGATTCCTCTGATGGATCTGGG + Intergenic
1045129443 8:99132589-99132611 GTGATTCCTCTGATGGATCTAGG - Intronic
1045232845 8:100321642-100321664 GTGATTCCTCTGATGGATCTGGG - Intronic
1045399911 8:101803551-101803573 GTGATTCCTCTGATGGATCTGGG + Intronic
1045862696 8:106831079-106831101 GCGCATGCTCTGATGGAGCTAGG - Intergenic
1045907717 8:107368061-107368083 ATGATTCCTCAGATGGATCTGGG - Intronic
1046514923 8:115246238-115246260 GTGATTCCTCTGATGGATCTGGG + Intergenic
1046744014 8:117857784-117857806 GTGATTCCTCTGATGGATCTGGG + Intronic
1047320088 8:123770929-123770951 TAGTAATCTCAGATGGAGCTCGG - Intronic
1047576795 8:126165088-126165110 GTGATTCCTCTGATGGATCTAGG - Intergenic
1047884571 8:129234948-129234970 TAGAATTCTCAGATGGTGCTAGG + Intergenic
1048091357 8:131243936-131243958 CAGAATCCACAGCAGGAGCTTGG + Intergenic
1048250754 8:132864884-132864906 GAGAAGCCTAGGATGGGGCTCGG + Intergenic
1048531681 8:135255683-135255705 GAGAATCCTGAGATGACGTTGGG - Intergenic
1048599342 8:135902462-135902484 TAGAGTCCTCAGAAGGAGCACGG - Intergenic
1048902566 8:139053076-139053098 GTGATTCCTCTGATGGATCTGGG + Intergenic
1049034718 8:140065966-140065988 GTGATTCCTCCGATGGATCTGGG + Intronic
1049069311 8:140344776-140344798 GAGAAACATCAGGTGGACCTGGG + Intronic
1049901333 9:169072-169094 GTGATTCCTCTGATGGATCTGGG + Intronic
1050383691 9:5060816-5060838 GTGATTCATCTGATGGAGCTGGG - Intronic
1050996945 9:12232496-12232518 AAGAAATCTCAGATGGAGATGGG - Intergenic
1051019441 9:12524257-12524279 GTGATTCCTCTGATGGATCTAGG + Intergenic
1051305274 9:15701922-15701944 GTGATTCCTCTGATGGATCTGGG - Intronic
1052060571 9:23955687-23955709 GTGATTCCTCTGATGGATCTGGG + Intergenic
1052758747 9:32568070-32568092 GTGATTCCTCTGATGGATCTAGG + Exonic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053421273 9:37980665-37980687 GTGATTCCTCTGATGGACCTGGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053744373 9:41179386-41179408 GTGATTCCTCTGATGGATCTAGG + Intronic
1054349647 9:64009311-64009333 GTGATTCCTCTGATGGATCTAGG + Intergenic
1054482896 9:65685809-65685831 GTGATTCCTCTGATGGATCTAGG - Intronic
1054683972 9:68251864-68251886 GTGATTCCTCTGATGGATCTAGG - Intronic
1054795708 9:69299672-69299694 GTGATTCCTCTGATGGATCTGGG - Intergenic
1055434814 9:76281994-76282016 GAGATTCCTCTGATGTATCTGGG + Intronic
1055542588 9:77327974-77327996 GTGATTCCTCTGATGGATCTGGG - Intronic
1055658847 9:78480814-78480836 GTGATTCCTCTGATGGATCTGGG - Intergenic
1056223547 9:84472925-84472947 GAGAAAGATCAGATTGAGCTTGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057823566 9:98353513-98353535 GAGATTTCTCTGATGGATCTGGG - Intronic
1058223611 9:102333242-102333264 GCAATTCCTCCGATGGAGCTGGG - Intergenic
1058920179 9:109606812-109606834 GTGATTCCTCTGATGGATCTGGG + Intergenic
1059158239 9:112009218-112009240 GTGATTCCTCTGATGGATCTGGG + Intergenic
1059936553 9:119317153-119317175 GGGATTCCTCTGATGGATCTGGG + Intronic
1060066531 9:120506500-120506522 GTGATTCCTCTGATGGATCTGGG + Intronic
1060565349 9:124586176-124586198 GTGATTCCTCTGATGGATCTAGG + Intronic
1061446025 9:130638629-130638651 GAGTGTCATCGGATGGAGCTGGG + Intergenic
1185961919 X:4553747-4553769 GAGAATGCTCAAATGCAGATTGG + Intergenic
1186105996 X:6206581-6206603 AAGAACCCTCAGAGGGAGCATGG - Intronic
1186188756 X:7048059-7048081 ATAAATCCTCAGATGGAGTTTGG - Intergenic
1186255928 X:7719551-7719573 GTGATTCCTCTGATGGATCTGGG - Intergenic
1186942244 X:14522545-14522567 GTGATTCCTCTAATGGAGCTGGG - Intergenic
1187074918 X:15924986-15925008 GTGAGTCCTCCGATGGATCTGGG + Intergenic
1187110782 X:16297618-16297640 GGGATTCCTCTGATGGATCTGGG - Intergenic
1187474315 X:19597062-19597084 GTGATTCCTCTGATGGATCTGGG - Intronic
1187489956 X:19741973-19741995 GAGAACCCTGAGATGGAACCTGG + Intronic
1187516714 X:19978233-19978255 GTGATTCCTCTGATGGATCTGGG + Intergenic
1187662833 X:21569671-21569693 GTGATTCCTCTGATGGATCTGGG - Intronic
1188540698 X:31247273-31247295 GTGATTCCTCTGATGGATCTGGG + Intronic
1188591499 X:31841998-31842020 GCGATTCCTCTGATGGATCTGGG + Intronic
1189951405 X:46235086-46235108 TGGAATTCTCAGAAGGAGCTAGG + Intergenic
1189951757 X:46239368-46239390 TAGATTCCTCTGATGGATCTAGG + Intergenic
1191943118 X:66501082-66501104 AAGAATGCCCATATGGAGCTTGG + Intergenic
1192668514 X:73113947-73113969 GTGATTCCTCAGATGGATCTGGG - Intergenic
1192848711 X:74931213-74931235 GAGAAGCCCCAGATGAAGCCAGG + Intergenic
1193685313 X:84571086-84571108 GTGATTCCTCTGATGGATCTGGG + Intergenic
1193926714 X:87495570-87495592 GTGACTCCTCTGATGGATCTGGG + Intergenic
1195095002 X:101493631-101493653 GAGAATCCTGGGCTGGATCTAGG + Exonic
1195593229 X:106656506-106656528 GTGATTCCTCTGATGGATCTGGG - Intronic
1197114135 X:122812173-122812195 GTGATTCCTCTGATGGATCTGGG + Intergenic
1197129265 X:122985612-122985634 GTGATTCCTCTGATGGAGCTGGG - Intergenic
1197557240 X:127970678-127970700 GTGATTCCTCTGATGGATCTGGG - Intergenic
1198333466 X:135643747-135643769 GAGAATCATCAGATTGTGTTTGG - Intergenic
1199208138 X:145173671-145173693 AAAAGTCCTCAGATGGAGCAAGG + Intergenic
1200126614 X:153818255-153818277 AAGAATCATGAGATGAAGCTGGG + Intronic
1201143873 Y:11051444-11051466 TAGATTCCTCAGATGGAGTTGGG + Intergenic
1202124790 Y:21557891-21557913 GAGAAGCCTGACATGGAGCCTGG - Intergenic
1202154218 Y:21871489-21871511 GAGAAGCCTGACATGGAGCCTGG + Intergenic