ID: 1005000206

View in Genome Browser
Species Human (GRCh38)
Location 6:21232686-21232708
Sequence AGGACTAGAAGCAGCACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005000206_1005000209 -3 Left 1005000206 6:21232686-21232708 CCTCCTGTGCTGCTTCTAGTCCT No data
Right 1005000209 6:21232706-21232728 CCTGCAGTGAAACATCCACTTGG No data
1005000206_1005000212 21 Left 1005000206 6:21232686-21232708 CCTCCTGTGCTGCTTCTAGTCCT No data
Right 1005000212 6:21232730-21232752 AGCACCCCTCACTTCTTAGCAGG No data
1005000206_1005000210 -2 Left 1005000206 6:21232686-21232708 CCTCCTGTGCTGCTTCTAGTCCT No data
Right 1005000210 6:21232707-21232729 CTGCAGTGAAACATCCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005000206 Original CRISPR AGGACTAGAAGCAGCACAGG AGG (reversed) Intergenic
No off target data available for this crispr