ID: 1005000593

View in Genome Browser
Species Human (GRCh38)
Location 6:21236586-21236608
Sequence CAGGAACAAGATTCCATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005000589_1005000593 9 Left 1005000589 6:21236554-21236576 CCACTTTTTCTTTTTGAGCCACA No data
Right 1005000593 6:21236586-21236608 CAGGAACAAGATTCCATTGTGGG No data
1005000591_1005000593 -9 Left 1005000591 6:21236572-21236594 CCACATCTCTAAAACAGGAACAA No data
Right 1005000593 6:21236586-21236608 CAGGAACAAGATTCCATTGTGGG No data
1005000587_1005000593 18 Left 1005000587 6:21236545-21236567 CCAGCCAGACCACTTTTTCTTTT No data
Right 1005000593 6:21236586-21236608 CAGGAACAAGATTCCATTGTGGG No data
1005000588_1005000593 14 Left 1005000588 6:21236549-21236571 CCAGACCACTTTTTCTTTTTGAG No data
Right 1005000593 6:21236586-21236608 CAGGAACAAGATTCCATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005000593 Original CRISPR CAGGAACAAGATTCCATTGT GGG Intergenic
No off target data available for this crispr