ID: 1005002234

View in Genome Browser
Species Human (GRCh38)
Location 6:21253559-21253581
Sequence GAGGGTGTGAGATGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005002234_1005002243 14 Left 1005002234 6:21253559-21253581 CCTTCCTCACATCTCACACCCTC No data
Right 1005002243 6:21253596-21253618 GAAGGGGGCTTTTATTGCTAAGG No data
1005002234_1005002240 -3 Left 1005002234 6:21253559-21253581 CCTTCCTCACATCTCACACCCTC No data
Right 1005002240 6:21253579-21253601 CTCAAGTGGCACAAAGAGAAGGG No data
1005002234_1005002241 -2 Left 1005002234 6:21253559-21253581 CCTTCCTCACATCTCACACCCTC No data
Right 1005002241 6:21253580-21253602 TCAAGTGGCACAAAGAGAAGGGG No data
1005002234_1005002239 -4 Left 1005002234 6:21253559-21253581 CCTTCCTCACATCTCACACCCTC No data
Right 1005002239 6:21253578-21253600 CCTCAAGTGGCACAAAGAGAAGG No data
1005002234_1005002242 -1 Left 1005002234 6:21253559-21253581 CCTTCCTCACATCTCACACCCTC No data
Right 1005002242 6:21253581-21253603 CAAGTGGCACAAAGAGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005002234 Original CRISPR GAGGGTGTGAGATGTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr