ID: 1005002242

View in Genome Browser
Species Human (GRCh38)
Location 6:21253581-21253603
Sequence CAAGTGGCACAAAGAGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005002227_1005002242 25 Left 1005002227 6:21253533-21253555 CCTCCCACCACCACCACATGGTC No data
Right 1005002242 6:21253581-21253603 CAAGTGGCACAAAGAGAAGGGGG No data
1005002230_1005002242 18 Left 1005002230 6:21253540-21253562 CCACCACCACATGGTCCTACCTT No data
Right 1005002242 6:21253581-21253603 CAAGTGGCACAAAGAGAAGGGGG No data
1005002229_1005002242 21 Left 1005002229 6:21253537-21253559 CCACCACCACCACATGGTCCTAC No data
Right 1005002242 6:21253581-21253603 CAAGTGGCACAAAGAGAAGGGGG No data
1005002231_1005002242 15 Left 1005002231 6:21253543-21253565 CCACCACATGGTCCTACCTTCCT No data
Right 1005002242 6:21253581-21253603 CAAGTGGCACAAAGAGAAGGGGG No data
1005002234_1005002242 -1 Left 1005002234 6:21253559-21253581 CCTTCCTCACATCTCACACCCTC No data
Right 1005002242 6:21253581-21253603 CAAGTGGCACAAAGAGAAGGGGG No data
1005002232_1005002242 12 Left 1005002232 6:21253546-21253568 CCACATGGTCCTACCTTCCTCAC No data
Right 1005002242 6:21253581-21253603 CAAGTGGCACAAAGAGAAGGGGG No data
1005002233_1005002242 3 Left 1005002233 6:21253555-21253577 CCTACCTTCCTCACATCTCACAC No data
Right 1005002242 6:21253581-21253603 CAAGTGGCACAAAGAGAAGGGGG No data
1005002235_1005002242 -5 Left 1005002235 6:21253563-21253585 CCTCACATCTCACACCCTCAAGT No data
Right 1005002242 6:21253581-21253603 CAAGTGGCACAAAGAGAAGGGGG No data
1005002228_1005002242 22 Left 1005002228 6:21253536-21253558 CCCACCACCACCACATGGTCCTA No data
Right 1005002242 6:21253581-21253603 CAAGTGGCACAAAGAGAAGGGGG No data
1005002226_1005002242 26 Left 1005002226 6:21253532-21253554 CCCTCCCACCACCACCACATGGT No data
Right 1005002242 6:21253581-21253603 CAAGTGGCACAAAGAGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005002242 Original CRISPR CAAGTGGCACAAAGAGAAGG GGG Intergenic
No off target data available for this crispr