ID: 1005002968

View in Genome Browser
Species Human (GRCh38)
Location 6:21261261-21261283
Sequence GAAACACTTAAGGTGAGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005002968_1005002973 11 Left 1005002968 6:21261261-21261283 CCAAGTCTCACCTTAAGTGTTTC No data
Right 1005002973 6:21261295-21261317 TTAGCTAAAGAAGAAGGAGGAGG No data
1005002968_1005002976 27 Left 1005002968 6:21261261-21261283 CCAAGTCTCACCTTAAGTGTTTC No data
Right 1005002976 6:21261311-21261333 GAGGAGGAGGAAGGAGAAGTAGG No data
1005002968_1005002971 5 Left 1005002968 6:21261261-21261283 CCAAGTCTCACCTTAAGTGTTTC No data
Right 1005002971 6:21261289-21261311 ATTACATTAGCTAAAGAAGAAGG No data
1005002968_1005002975 18 Left 1005002968 6:21261261-21261283 CCAAGTCTCACCTTAAGTGTTTC No data
Right 1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG 0: 36
1: 155
2: 521
3: 2021
4: 6837
1005002968_1005002977 30 Left 1005002968 6:21261261-21261283 CCAAGTCTCACCTTAAGTGTTTC No data
Right 1005002977 6:21261314-21261336 GAGGAGGAAGGAGAAGTAGGAGG No data
1005002968_1005002972 8 Left 1005002968 6:21261261-21261283 CCAAGTCTCACCTTAAGTGTTTC No data
Right 1005002972 6:21261292-21261314 ACATTAGCTAAAGAAGAAGGAGG No data
1005002968_1005002974 14 Left 1005002968 6:21261261-21261283 CCAAGTCTCACCTTAAGTGTTTC No data
Right 1005002974 6:21261298-21261320 GCTAAAGAAGAAGGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005002968 Original CRISPR GAAACACTTAAGGTGAGACT TGG (reversed) Intergenic
No off target data available for this crispr