ID: 1005002970

View in Genome Browser
Species Human (GRCh38)
Location 6:21261283-21261305
Sequence TCTTTAGCTAATGTAATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005002970_1005002974 -8 Left 1005002970 6:21261283-21261305 CCTTTAATTACATTAGCTAAAGA No data
Right 1005002974 6:21261298-21261320 GCTAAAGAAGAAGGAGGAGGAGG No data
1005002970_1005002976 5 Left 1005002970 6:21261283-21261305 CCTTTAATTACATTAGCTAAAGA No data
Right 1005002976 6:21261311-21261333 GAGGAGGAGGAAGGAGAAGTAGG No data
1005002970_1005002977 8 Left 1005002970 6:21261283-21261305 CCTTTAATTACATTAGCTAAAGA No data
Right 1005002977 6:21261314-21261336 GAGGAGGAAGGAGAAGTAGGAGG No data
1005002970_1005002975 -4 Left 1005002970 6:21261283-21261305 CCTTTAATTACATTAGCTAAAGA No data
Right 1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG 0: 36
1: 155
2: 521
3: 2021
4: 6837

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005002970 Original CRISPR TCTTTAGCTAATGTAATTAA AGG (reversed) Intergenic
No off target data available for this crispr