ID: 1005002975

View in Genome Browser
Species Human (GRCh38)
Location 6:21261302-21261324
Sequence AAGAAGAAGGAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9570
Summary {0: 36, 1: 155, 2: 521, 3: 2021, 4: 6837}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005002968_1005002975 18 Left 1005002968 6:21261261-21261283 CCAAGTCTCACCTTAAGTGTTTC No data
Right 1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG 0: 36
1: 155
2: 521
3: 2021
4: 6837
1005002970_1005002975 -4 Left 1005002970 6:21261283-21261305 CCTTTAATTACATTAGCTAAAGA No data
Right 1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG 0: 36
1: 155
2: 521
3: 2021
4: 6837
1005002969_1005002975 8 Left 1005002969 6:21261271-21261293 CCTTAAGTGTTTCCTTTAATTAC No data
Right 1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG 0: 36
1: 155
2: 521
3: 2021
4: 6837

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005002975 Original CRISPR AAGAAGAAGGAGGAGGAGGA AGG Intergenic
Too many off-targets to display for this crispr