ID: 1005006200

View in Genome Browser
Species Human (GRCh38)
Location 6:21289945-21289967
Sequence ACTCTTGGCTTTACACTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005006195_1005006200 18 Left 1005006195 6:21289904-21289926 CCTGGACACGTCTGCTTCCTTGA No data
Right 1005006200 6:21289945-21289967 ACTCTTGGCTTTACACTTCCAGG No data
1005006194_1005006200 24 Left 1005006194 6:21289898-21289920 CCAACTCCTGGACACGTCTGCTT No data
Right 1005006200 6:21289945-21289967 ACTCTTGGCTTTACACTTCCAGG No data
1005006198_1005006200 1 Left 1005006198 6:21289921-21289943 CCTTGAAGAGGGCTCTGTCACTC No data
Right 1005006200 6:21289945-21289967 ACTCTTGGCTTTACACTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005006200 Original CRISPR ACTCTTGGCTTTACACTTCC AGG Intergenic
No off target data available for this crispr