ID: 1005007193

View in Genome Browser
Species Human (GRCh38)
Location 6:21299297-21299319
Sequence GATTCCTATTTTTAACTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005007188_1005007193 9 Left 1005007188 6:21299265-21299287 CCCTACTGTCAAGGATATACCTA No data
Right 1005007193 6:21299297-21299319 GATTCCTATTTTTAACTGGTGGG No data
1005007190_1005007193 -10 Left 1005007190 6:21299284-21299306 CCTATAAACATTAGATTCCTATT No data
Right 1005007193 6:21299297-21299319 GATTCCTATTTTTAACTGGTGGG No data
1005007189_1005007193 8 Left 1005007189 6:21299266-21299288 CCTACTGTCAAGGATATACCTAT No data
Right 1005007193 6:21299297-21299319 GATTCCTATTTTTAACTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005007193 Original CRISPR GATTCCTATTTTTAACTGGT GGG Intergenic
No off target data available for this crispr