ID: 1005016259

View in Genome Browser
Species Human (GRCh38)
Location 6:21377981-21378003
Sequence CAGGGGAAGGAGAGGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005016253_1005016259 -9 Left 1005016253 6:21377967-21377989 CCTGTGTTTAAGGCCAGGGGAAG No data
Right 1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG No data
1005016248_1005016259 2 Left 1005016248 6:21377956-21377978 CCTAAGGAGCTCCTGTGTTTAAG No data
Right 1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005016259 Original CRISPR CAGGGGAAGGAGAGGGATGA GGG Intergenic
No off target data available for this crispr