ID: 1005020512

View in Genome Browser
Species Human (GRCh38)
Location 6:21413637-21413659
Sequence CTTTCAACTCTGAAATTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005020512_1005020513 -2 Left 1005020512 6:21413637-21413659 CCAGGCAATTTCAGAGTTGAAAG No data
Right 1005020513 6:21413658-21413680 AGTGTCTTAAAGAAAATCCAAGG No data
1005020512_1005020517 20 Left 1005020512 6:21413637-21413659 CCAGGCAATTTCAGAGTTGAAAG No data
Right 1005020517 6:21413680-21413702 GAAGCTTATTCTTGGCTAGGTGG No data
1005020512_1005020514 12 Left 1005020512 6:21413637-21413659 CCAGGCAATTTCAGAGTTGAAAG No data
Right 1005020514 6:21413672-21413694 AATCCAAGGAAGCTTATTCTTGG No data
1005020512_1005020516 17 Left 1005020512 6:21413637-21413659 CCAGGCAATTTCAGAGTTGAAAG No data
Right 1005020516 6:21413677-21413699 AAGGAAGCTTATTCTTGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005020512 Original CRISPR CTTTCAACTCTGAAATTGCC TGG (reversed) Intergenic
No off target data available for this crispr