ID: 1005020589

View in Genome Browser
Species Human (GRCh38)
Location 6:21414566-21414588
Sequence ATTGTATGTTGGGGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005020589_1005020594 -5 Left 1005020589 6:21414566-21414588 CCTTTTTTCCCCCAACATACAAT No data
Right 1005020594 6:21414584-21414606 ACAATGTTGCAAAACTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005020589 Original CRISPR ATTGTATGTTGGGGGAAAAA AGG (reversed) Intergenic
No off target data available for this crispr