ID: 1005020894

View in Genome Browser
Species Human (GRCh38)
Location 6:21417807-21417829
Sequence TTGGATTTGCATAATGTTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005020894_1005020897 -5 Left 1005020894 6:21417807-21417829 CCGTCAACATTATGCAAATCCAA No data
Right 1005020897 6:21417825-21417847 TCCAAAGAACGATGGAGGTTTGG No data
1005020894_1005020896 -10 Left 1005020894 6:21417807-21417829 CCGTCAACATTATGCAAATCCAA No data
Right 1005020896 6:21417820-21417842 GCAAATCCAAAGAACGATGGAGG No data
1005020894_1005020899 0 Left 1005020894 6:21417807-21417829 CCGTCAACATTATGCAAATCCAA No data
Right 1005020899 6:21417830-21417852 AGAACGATGGAGGTTTGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005020894 Original CRISPR TTGGATTTGCATAATGTTGA CGG (reversed) Intergenic
No off target data available for this crispr