ID: 1005023469

View in Genome Browser
Species Human (GRCh38)
Location 6:21440029-21440051
Sequence TCTCATTAAGTCCTATGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005023469_1005023471 15 Left 1005023469 6:21440029-21440051 CCTTAACATAGGACTTAATGAGA No data
Right 1005023471 6:21440067-21440089 TGTGGTGACTCCTCAAACTCAGG No data
1005023469_1005023470 -3 Left 1005023469 6:21440029-21440051 CCTTAACATAGGACTTAATGAGA No data
Right 1005023470 6:21440049-21440071 AGATTTGTTGTGTATATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005023469 Original CRISPR TCTCATTAAGTCCTATGTTA AGG (reversed) Intergenic
No off target data available for this crispr