ID: 1005027541

View in Genome Browser
Species Human (GRCh38)
Location 6:21477887-21477909
Sequence ACAATTGGACTACAAGTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005027541_1005027544 28 Left 1005027541 6:21477887-21477909 CCAATCACTTGTAGTCCAATTGT No data
Right 1005027544 6:21477938-21477960 TCTGTTAAGCAGACAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005027541 Original CRISPR ACAATTGGACTACAAGTGAT TGG (reversed) Intergenic
No off target data available for this crispr