ID: 1005027544

View in Genome Browser
Species Human (GRCh38)
Location 6:21477938-21477960
Sequence TCTGTTAAGCAGACAGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005027541_1005027544 28 Left 1005027541 6:21477887-21477909 CCAATCACTTGTAGTCCAATTGT No data
Right 1005027544 6:21477938-21477960 TCTGTTAAGCAGACAGCTCCAGG No data
1005027543_1005027544 13 Left 1005027543 6:21477902-21477924 CCAATTGTGGAGTCATTGCTTAA No data
Right 1005027544 6:21477938-21477960 TCTGTTAAGCAGACAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005027544 Original CRISPR TCTGTTAAGCAGACAGCTCC AGG Intergenic
No off target data available for this crispr