ID: 1005030043

View in Genome Browser
Species Human (GRCh38)
Location 6:21500051-21500073
Sequence AGACATAAGCAGAGGATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005030043_1005030052 30 Left 1005030043 6:21500051-21500073 CCCAGAATCCTCTGCTTATGTCT No data
Right 1005030052 6:21500104-21500126 CAGATGCACAGAGTCTGGATAGG No data
1005030043_1005030049 25 Left 1005030043 6:21500051-21500073 CCCAGAATCCTCTGCTTATGTCT No data
Right 1005030049 6:21500099-21500121 ATGCCCAGATGCACAGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005030043 Original CRISPR AGACATAAGCAGAGGATTCT GGG (reversed) Intergenic
No off target data available for this crispr