ID: 1005030271

View in Genome Browser
Species Human (GRCh38)
Location 6:21501967-21501989
Sequence GTATAGTCCAAGGCTAAAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005030268_1005030271 7 Left 1005030268 6:21501937-21501959 CCATTACTGCCTCTCATATTCTG No data
Right 1005030271 6:21501967-21501989 GTATAGTCCAAGGCTAAAAGCGG No data
1005030269_1005030271 -2 Left 1005030269 6:21501946-21501968 CCTCTCATATTCTGTGCATGAGT No data
Right 1005030271 6:21501967-21501989 GTATAGTCCAAGGCTAAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005030271 Original CRISPR GTATAGTCCAAGGCTAAAAG CGG Intergenic
No off target data available for this crispr