ID: 1005030652

View in Genome Browser
Species Human (GRCh38)
Location 6:21505688-21505710
Sequence TGTCCACTAGAATCACATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005030646_1005030652 28 Left 1005030646 6:21505637-21505659 CCTTTCCTTCCTGTAGTTGGTTG No data
Right 1005030652 6:21505688-21505710 TGTCCACTAGAATCACATGGAGG No data
1005030647_1005030652 23 Left 1005030647 6:21505642-21505664 CCTTCCTGTAGTTGGTTGTTTTA No data
Right 1005030652 6:21505688-21505710 TGTCCACTAGAATCACATGGAGG No data
1005030650_1005030652 19 Left 1005030650 6:21505646-21505668 CCTGTAGTTGGTTGTTTTAGGGA No data
Right 1005030652 6:21505688-21505710 TGTCCACTAGAATCACATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005030652 Original CRISPR TGTCCACTAGAATCACATGG AGG Intergenic
No off target data available for this crispr