ID: 1005036288

View in Genome Browser
Species Human (GRCh38)
Location 6:21558102-21558124
Sequence TTTCCATATATGAATTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005036288_1005036300 20 Left 1005036288 6:21558102-21558124 CCCCCAAAATTCATATATGGAAA No data
Right 1005036300 6:21558145-21558167 TGTTAGGAAGTGGGGATTTGGGG No data
1005036288_1005036299 19 Left 1005036288 6:21558102-21558124 CCCCCAAAATTCATATATGGAAA No data
Right 1005036299 6:21558144-21558166 ATGTTAGGAAGTGGGGATTTGGG No data
1005036288_1005036298 18 Left 1005036288 6:21558102-21558124 CCCCCAAAATTCATATATGGAAA No data
Right 1005036298 6:21558143-21558165 GATGTTAGGAAGTGGGGATTTGG No data
1005036288_1005036297 12 Left 1005036288 6:21558102-21558124 CCCCCAAAATTCATATATGGAAA No data
Right 1005036297 6:21558137-21558159 TGTGATGATGTTAGGAAGTGGGG No data
1005036288_1005036293 4 Left 1005036288 6:21558102-21558124 CCCCCAAAATTCATATATGGAAA No data
Right 1005036293 6:21558129-21558151 CTCACCAATGTGATGATGTTAGG No data
1005036288_1005036295 10 Left 1005036288 6:21558102-21558124 CCCCCAAAATTCATATATGGAAA No data
Right 1005036295 6:21558135-21558157 AATGTGATGATGTTAGGAAGTGG No data
1005036288_1005036301 23 Left 1005036288 6:21558102-21558124 CCCCCAAAATTCATATATGGAAA No data
Right 1005036301 6:21558148-21558170 TAGGAAGTGGGGATTTGGGGAGG No data
1005036288_1005036296 11 Left 1005036288 6:21558102-21558124 CCCCCAAAATTCATATATGGAAA No data
Right 1005036296 6:21558136-21558158 ATGTGATGATGTTAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005036288 Original CRISPR TTTCCATATATGAATTTTGG GGG (reversed) Intergenic
No off target data available for this crispr