ID: 1005036290

View in Genome Browser
Species Human (GRCh38)
Location 6:21558104-21558126
Sequence GGTTTCCATATATGAATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005036290_1005036298 16 Left 1005036290 6:21558104-21558126 CCCAAAATTCATATATGGAAACC No data
Right 1005036298 6:21558143-21558165 GATGTTAGGAAGTGGGGATTTGG No data
1005036290_1005036296 9 Left 1005036290 6:21558104-21558126 CCCAAAATTCATATATGGAAACC No data
Right 1005036296 6:21558136-21558158 ATGTGATGATGTTAGGAAGTGGG No data
1005036290_1005036299 17 Left 1005036290 6:21558104-21558126 CCCAAAATTCATATATGGAAACC No data
Right 1005036299 6:21558144-21558166 ATGTTAGGAAGTGGGGATTTGGG No data
1005036290_1005036302 29 Left 1005036290 6:21558104-21558126 CCCAAAATTCATATATGGAAACC No data
Right 1005036302 6:21558156-21558178 GGGGATTTGGGGAGGTGATTAGG No data
1005036290_1005036293 2 Left 1005036290 6:21558104-21558126 CCCAAAATTCATATATGGAAACC No data
Right 1005036293 6:21558129-21558151 CTCACCAATGTGATGATGTTAGG No data
1005036290_1005036301 21 Left 1005036290 6:21558104-21558126 CCCAAAATTCATATATGGAAACC No data
Right 1005036301 6:21558148-21558170 TAGGAAGTGGGGATTTGGGGAGG No data
1005036290_1005036300 18 Left 1005036290 6:21558104-21558126 CCCAAAATTCATATATGGAAACC No data
Right 1005036300 6:21558145-21558167 TGTTAGGAAGTGGGGATTTGGGG No data
1005036290_1005036297 10 Left 1005036290 6:21558104-21558126 CCCAAAATTCATATATGGAAACC No data
Right 1005036297 6:21558137-21558159 TGTGATGATGTTAGGAAGTGGGG No data
1005036290_1005036295 8 Left 1005036290 6:21558104-21558126 CCCAAAATTCATATATGGAAACC No data
Right 1005036295 6:21558135-21558157 AATGTGATGATGTTAGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005036290 Original CRISPR GGTTTCCATATATGAATTTT GGG (reversed) Intergenic
No off target data available for this crispr