ID: 1005036298

View in Genome Browser
Species Human (GRCh38)
Location 6:21558143-21558165
Sequence GATGTTAGGAAGTGGGGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005036289_1005036298 17 Left 1005036289 6:21558103-21558125 CCCCAAAATTCATATATGGAAAC No data
Right 1005036298 6:21558143-21558165 GATGTTAGGAAGTGGGGATTTGG No data
1005036288_1005036298 18 Left 1005036288 6:21558102-21558124 CCCCCAAAATTCATATATGGAAA No data
Right 1005036298 6:21558143-21558165 GATGTTAGGAAGTGGGGATTTGG No data
1005036292_1005036298 -5 Left 1005036292 6:21558125-21558147 CCTACTCACCAATGTGATGATGT No data
Right 1005036298 6:21558143-21558165 GATGTTAGGAAGTGGGGATTTGG No data
1005036287_1005036298 19 Left 1005036287 6:21558101-21558123 CCCCCCAAAATTCATATATGGAA No data
Right 1005036298 6:21558143-21558165 GATGTTAGGAAGTGGGGATTTGG No data
1005036290_1005036298 16 Left 1005036290 6:21558104-21558126 CCCAAAATTCATATATGGAAACC No data
Right 1005036298 6:21558143-21558165 GATGTTAGGAAGTGGGGATTTGG No data
1005036291_1005036298 15 Left 1005036291 6:21558105-21558127 CCAAAATTCATATATGGAAACCT No data
Right 1005036298 6:21558143-21558165 GATGTTAGGAAGTGGGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005036298 Original CRISPR GATGTTAGGAAGTGGGGATT TGG Intergenic
No off target data available for this crispr