ID: 1005039739

View in Genome Browser
Species Human (GRCh38)
Location 6:21589961-21589983
Sequence CTGAAAGGCGCCAGTTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005039739_1005039746 27 Left 1005039739 6:21589961-21589983 CCAAAAAAACTGGCGCCTTTCAG No data
Right 1005039746 6:21590011-21590033 CCCAGGGCTTCTTCCTTGTCAGG No data
1005039739_1005039743 10 Left 1005039739 6:21589961-21589983 CCAAAAAAACTGGCGCCTTTCAG No data
Right 1005039743 6:21589994-21590016 CCAATGACATCAGATTTCCCAGG No data
1005039739_1005039744 11 Left 1005039739 6:21589961-21589983 CCAAAAAAACTGGCGCCTTTCAG No data
Right 1005039744 6:21589995-21590017 CAATGACATCAGATTTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005039739 Original CRISPR CTGAAAGGCGCCAGTTTTTT TGG (reversed) Intergenic
No off target data available for this crispr