ID: 1005039741

View in Genome Browser
Species Human (GRCh38)
Location 6:21589976-21589998
Sequence ATTGGCCTTTGTCAACTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005039741_1005039743 -5 Left 1005039741 6:21589976-21589998 CCTTTCAGTTGACAAAGGCCAAT No data
Right 1005039743 6:21589994-21590016 CCAATGACATCAGATTTCCCAGG No data
1005039741_1005039746 12 Left 1005039741 6:21589976-21589998 CCTTTCAGTTGACAAAGGCCAAT No data
Right 1005039746 6:21590011-21590033 CCCAGGGCTTCTTCCTTGTCAGG No data
1005039741_1005039744 -4 Left 1005039741 6:21589976-21589998 CCTTTCAGTTGACAAAGGCCAAT No data
Right 1005039744 6:21589995-21590017 CAATGACATCAGATTTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005039741 Original CRISPR ATTGGCCTTTGTCAACTGAA AGG (reversed) Intergenic
No off target data available for this crispr