ID: 1005039744

View in Genome Browser
Species Human (GRCh38)
Location 6:21589995-21590017
Sequence CAATGACATCAGATTTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005039741_1005039744 -4 Left 1005039741 6:21589976-21589998 CCTTTCAGTTGACAAAGGCCAAT No data
Right 1005039744 6:21589995-21590017 CAATGACATCAGATTTCCCAGGG No data
1005039739_1005039744 11 Left 1005039739 6:21589961-21589983 CCAAAAAAACTGGCGCCTTTCAG No data
Right 1005039744 6:21589995-21590017 CAATGACATCAGATTTCCCAGGG No data
1005039737_1005039744 26 Left 1005039737 6:21589946-21589968 CCATAAAGTGTGGAACCAAAAAA No data
Right 1005039744 6:21589995-21590017 CAATGACATCAGATTTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005039744 Original CRISPR CAATGACATCAGATTTCCCA GGG Intergenic
No off target data available for this crispr